ID: 1080196234

View in Genome Browser
Species Human (GRCh38)
Location 11:29612692-29612714
Sequence ATTTTGAGAACTAGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196234_1080196240 23 Left 1080196234 11:29612692-29612714 CCCTCCTCTCTAGTTCTCAAAAT No data
Right 1080196240 11:29612738-29612760 CTCCAGAGCTATCTCCTCTATGG No data
1080196234_1080196238 0 Left 1080196234 11:29612692-29612714 CCCTCCTCTCTAGTTCTCAAAAT No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
1080196234_1080196242 30 Left 1080196234 11:29612692-29612714 CCCTCCTCTCTAGTTCTCAAAAT No data
Right 1080196242 11:29612745-29612767 GCTATCTCCTCTATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196234 Original CRISPR ATTTTGAGAACTAGAGAGGA GGG (reversed) Intergenic