ID: 1080196237

View in Genome Browser
Species Human (GRCh38)
Location 11:29612715-29612737
Sequence CCAGATCTAAAAGGATTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196237_1080196240 0 Left 1080196237 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
Right 1080196240 11:29612738-29612760 CTCCAGAGCTATCTCCTCTATGG No data
1080196237_1080196242 7 Left 1080196237 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
Right 1080196242 11:29612745-29612767 GCTATCTCCTCTATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196237 Original CRISPR CCAGATCTAAAAGGATTGTC AGG (reversed) Intergenic