ID: 1080196238

View in Genome Browser
Species Human (GRCh38)
Location 11:29612715-29612737
Sequence CCTGACAATCCTTTTAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196234_1080196238 0 Left 1080196234 11:29612692-29612714 CCCTCCTCTCTAGTTCTCAAAAT No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
1080196233_1080196238 12 Left 1080196233 11:29612680-29612702 CCTGCTGGTCAACCCTCCTCTCT No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
1080196235_1080196238 -1 Left 1080196235 11:29612693-29612715 CCTCCTCTCTAGTTCTCAAAATC No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
1080196231_1080196238 23 Left 1080196231 11:29612669-29612691 CCACCGGGACTCCTGCTGGTCAA No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
1080196232_1080196238 20 Left 1080196232 11:29612672-29612694 CCGGGACTCCTGCTGGTCAACCC No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
1080196236_1080196238 -4 Left 1080196236 11:29612696-29612718 CCTCTCTAGTTCTCAAAATCCTG No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
1080196230_1080196238 24 Left 1080196230 11:29612668-29612690 CCCACCGGGACTCCTGCTGGTCA No data
Right 1080196238 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196238 Original CRISPR CCTGACAATCCTTTTAGATC TGG Intergenic