ID: 1080196239

View in Genome Browser
Species Human (GRCh38)
Location 11:29612724-29612746
Sequence GCTCTGGAGCCAGATCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196239_1080196245 25 Left 1080196239 11:29612724-29612746 CCTTTTAGATCTGGCTCCAGAGC No data
Right 1080196245 11:29612772-29612794 AATTTCTCCGTCCCACAGTAGGG No data
1080196239_1080196244 24 Left 1080196239 11:29612724-29612746 CCTTTTAGATCTGGCTCCAGAGC No data
Right 1080196244 11:29612771-29612793 TAATTTCTCCGTCCCACAGTAGG No data
1080196239_1080196242 -2 Left 1080196239 11:29612724-29612746 CCTTTTAGATCTGGCTCCAGAGC No data
Right 1080196242 11:29612745-29612767 GCTATCTCCTCTATGGAAAAAGG No data
1080196239_1080196240 -9 Left 1080196239 11:29612724-29612746 CCTTTTAGATCTGGCTCCAGAGC No data
Right 1080196240 11:29612738-29612760 CTCCAGAGCTATCTCCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196239 Original CRISPR GCTCTGGAGCCAGATCTAAA AGG (reversed) Intergenic