ID: 1080196240

View in Genome Browser
Species Human (GRCh38)
Location 11:29612738-29612760
Sequence CTCCAGAGCTATCTCCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196234_1080196240 23 Left 1080196234 11:29612692-29612714 CCCTCCTCTCTAGTTCTCAAAAT No data
Right 1080196240 11:29612738-29612760 CTCCAGAGCTATCTCCTCTATGG No data
1080196236_1080196240 19 Left 1080196236 11:29612696-29612718 CCTCTCTAGTTCTCAAAATCCTG No data
Right 1080196240 11:29612738-29612760 CTCCAGAGCTATCTCCTCTATGG No data
1080196237_1080196240 0 Left 1080196237 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
Right 1080196240 11:29612738-29612760 CTCCAGAGCTATCTCCTCTATGG No data
1080196235_1080196240 22 Left 1080196235 11:29612693-29612715 CCTCCTCTCTAGTTCTCAAAATC No data
Right 1080196240 11:29612738-29612760 CTCCAGAGCTATCTCCTCTATGG No data
1080196239_1080196240 -9 Left 1080196239 11:29612724-29612746 CCTTTTAGATCTGGCTCCAGAGC No data
Right 1080196240 11:29612738-29612760 CTCCAGAGCTATCTCCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196240 Original CRISPR CTCCAGAGCTATCTCCTCTA TGG Intergenic