ID: 1080196242

View in Genome Browser
Species Human (GRCh38)
Location 11:29612745-29612767
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080196234_1080196242 30 Left 1080196234 11:29612692-29612714 CCCTCCTCTCTAGTTCTCAAAAT No data
Right 1080196242 11:29612745-29612767 GCTATCTCCTCTATGGAAAAAGG No data
1080196239_1080196242 -2 Left 1080196239 11:29612724-29612746 CCTTTTAGATCTGGCTCCAGAGC No data
Right 1080196242 11:29612745-29612767 GCTATCTCCTCTATGGAAAAAGG No data
1080196237_1080196242 7 Left 1080196237 11:29612715-29612737 CCTGACAATCCTTTTAGATCTGG No data
Right 1080196242 11:29612745-29612767 GCTATCTCCTCTATGGAAAAAGG No data
1080196235_1080196242 29 Left 1080196235 11:29612693-29612715 CCTCCTCTCTAGTTCTCAAAATC No data
Right 1080196242 11:29612745-29612767 GCTATCTCCTCTATGGAAAAAGG No data
1080196236_1080196242 26 Left 1080196236 11:29612696-29612718 CCTCTCTAGTTCTCAAAATCCTG No data
Right 1080196242 11:29612745-29612767 GCTATCTCCTCTATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080196242 Original CRISPR GCTATCTCCTCTATGGAAAA AGG Intergenic