ID: 1080202254

View in Genome Browser
Species Human (GRCh38)
Location 11:29686023-29686045
Sequence ACATACAGAATACACTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080202254_1080202256 -3 Left 1080202254 11:29686023-29686045 CCTTCCAAGTGTATTCTGTATGT No data
Right 1080202256 11:29686043-29686065 TGTCATTAGTCTACACATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080202254 Original CRISPR ACATACAGAATACACTTGGA AGG (reversed) Intergenic
No off target data available for this crispr