ID: 1080204500

View in Genome Browser
Species Human (GRCh38)
Location 11:29713075-29713097
Sequence GGCCCCAGTGCAGGATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080204495_1080204500 16 Left 1080204495 11:29713036-29713058 CCAGTGCACAGCGCAGGACTGGC No data
Right 1080204500 11:29713075-29713097 GGCCCCAGTGCAGGATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080204500 Original CRISPR GGCCCCAGTGCAGGATCCAC TGG Intergenic
No off target data available for this crispr