ID: 1080204986

View in Genome Browser
Species Human (GRCh38)
Location 11:29717886-29717908
Sequence CAAAATGCTGATAATAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080204986_1080204990 5 Left 1080204986 11:29717886-29717908 CCCATATTATTATCAGCATTTTG No data
Right 1080204990 11:29717914-29717936 AGCCATTTAACAAGTTTCTAGGG No data
1080204986_1080204989 4 Left 1080204986 11:29717886-29717908 CCCATATTATTATCAGCATTTTG No data
Right 1080204989 11:29717913-29717935 AAGCCATTTAACAAGTTTCTAGG 0: 6
1: 142
2: 1742
3: 1987
4: 1583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080204986 Original CRISPR CAAAATGCTGATAATAATAT GGG (reversed) Intergenic
No off target data available for this crispr