ID: 1080206810

View in Genome Browser
Species Human (GRCh38)
Location 11:29738818-29738840
Sequence GAACTAAAGTTGCTACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080206810_1080206813 5 Left 1080206810 11:29738818-29738840 CCAGCTTGTAGCAACTTTAGTTC No data
Right 1080206813 11:29738846-29738868 GATAGTATCAGGTCAGCTTCTGG No data
1080206810_1080206812 -6 Left 1080206810 11:29738818-29738840 CCAGCTTGTAGCAACTTTAGTTC No data
Right 1080206812 11:29738835-29738857 TAGTTCTGGCTGATAGTATCAGG No data
1080206810_1080206814 13 Left 1080206810 11:29738818-29738840 CCAGCTTGTAGCAACTTTAGTTC No data
Right 1080206814 11:29738854-29738876 CAGGTCAGCTTCTGGATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080206810 Original CRISPR GAACTAAAGTTGCTACAAGC TGG (reversed) Intergenic
No off target data available for this crispr