ID: 1080209046

View in Genome Browser
Species Human (GRCh38)
Location 11:29764100-29764122
Sequence CAAACACTTGGAGCATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080209046_1080209048 0 Left 1080209046 11:29764100-29764122 CCAAAGGATGCTCCAAGTGTTTG No data
Right 1080209048 11:29764123-29764145 ACACTTCTTTTTTCCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080209046 Original CRISPR CAAACACTTGGAGCATCCTT TGG (reversed) Intergenic
No off target data available for this crispr