ID: 1080209911

View in Genome Browser
Species Human (GRCh38)
Location 11:29773702-29773724
Sequence TTGATTGGTCTTCTAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080209909_1080209911 0 Left 1080209909 11:29773679-29773701 CCTTGGACTTGAATTTCTTGGAC No data
Right 1080209911 11:29773702-29773724 TTGATTGGTCTTCTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080209911 Original CRISPR TTGATTGGTCTTCTAGAGAC AGG Intergenic
No off target data available for this crispr