ID: 1080212680

View in Genome Browser
Species Human (GRCh38)
Location 11:29805282-29805304
Sequence CACAGCACTCTGAACTGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080212673_1080212680 20 Left 1080212673 11:29805239-29805261 CCAGATTTTCTCTTTGTGTAGTG No data
Right 1080212680 11:29805282-29805304 CACAGCACTCTGAACTGGTTAGG No data
1080212675_1080212680 -8 Left 1080212675 11:29805267-29805289 CCTCCATGTCTCTCCCACAGCAC No data
Right 1080212680 11:29805282-29805304 CACAGCACTCTGAACTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080212680 Original CRISPR CACAGCACTCTGAACTGGTT AGG Intergenic
No off target data available for this crispr