ID: 1080213117

View in Genome Browser
Species Human (GRCh38)
Location 11:29810022-29810044
Sequence CTGTAATAATGATAGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080213115_1080213117 -3 Left 1080213115 11:29810002-29810024 CCATTAAAAATTTCAAATAGCTG No data
Right 1080213117 11:29810022-29810044 CTGTAATAATGATAGGAAATTGG No data
1080213114_1080213117 0 Left 1080213114 11:29809999-29810021 CCTCCATTAAAAATTTCAAATAG No data
Right 1080213117 11:29810022-29810044 CTGTAATAATGATAGGAAATTGG No data
1080213113_1080213117 29 Left 1080213113 11:29809970-29809992 CCAATACATTGCAGTATTGGTTA No data
Right 1080213117 11:29810022-29810044 CTGTAATAATGATAGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080213117 Original CRISPR CTGTAATAATGATAGGAAAT TGG Intergenic
No off target data available for this crispr