ID: 1080219520

View in Genome Browser
Species Human (GRCh38)
Location 11:29884891-29884913
Sequence CTACTATGATTTAGTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080219518_1080219520 19 Left 1080219518 11:29884849-29884871 CCAAGTACAATAAGACTAAAATT No data
Right 1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080219520 Original CRISPR CTACTATGATTTAGTAAAAA TGG Intergenic
No off target data available for this crispr