ID: 1080228669

View in Genome Browser
Species Human (GRCh38)
Location 11:29990455-29990477
Sequence GGCCCATTTTGCCACTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080228669_1080228671 0 Left 1080228669 11:29990455-29990477 CCATCAAAGTGGCAAAATGGGCC No data
Right 1080228671 11:29990478-29990500 AGAGATAAAAAAGTTTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080228669 Original CRISPR GGCCCATTTTGCCACTTTGA TGG (reversed) Intergenic
No off target data available for this crispr