ID: 1080230032

View in Genome Browser
Species Human (GRCh38)
Location 11:30010829-30010851
Sequence GAGTATCTAGAGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080230032_1080230034 -7 Left 1080230032 11:30010829-30010851 CCTTCTTCCATCTCTAGATACTC 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1080230034 11:30010845-30010867 GATACTCTGACTTGTCCCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 77
1080230032_1080230035 -6 Left 1080230032 11:30010829-30010851 CCTTCTTCCATCTCTAGATACTC 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1080230035 11:30010846-30010868 ATACTCTGACTTGTCCCCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080230032 Original CRISPR GAGTATCTAGAGATGGAAGA AGG (reversed) Exonic
901154980 1:7129799-7129821 GGTTGTCTAGAGATGGGAGAGGG - Intronic
902113108 1:14099427-14099449 GAGTATCTGGTGAAGGAACAGGG - Intergenic
902612184 1:17603740-17603762 GAGAATCTGGAGATGGCTGAGGG + Intronic
903616745 1:24665074-24665096 TAGGATTTAGAGATGGAGGAAGG + Intronic
904944015 1:34185851-34185873 GTGCATCTAGAGATGGAGGCAGG - Intronic
905400358 1:37697756-37697778 TTGTTTCTAGAGATGGCAGAAGG + Intronic
906288236 1:44602451-44602473 GAGTATCTAGAGACTGCGGATGG + Intronic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
909303432 1:74042365-74042387 GAGTATTTATAGATAGAAAATGG + Intronic
911795824 1:102074952-102074974 GAATCTGTAGAGATGGAGGATGG - Intergenic
912575904 1:110673206-110673228 GAGTATATGGTGATCGAAGAGGG - Exonic
912811479 1:112798443-112798465 GAGCAGCTGGAGATGTAAGAAGG + Intergenic
914980243 1:152408891-152408913 GATTACCAAGAAATGGAAGAAGG - Intergenic
915842725 1:159229082-159229104 GAGTATCTATAAATGCAAGCTGG + Intergenic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
922499857 1:226088780-226088802 GAGAATCTAGGGAGAGAAGAGGG - Intergenic
922503388 1:226112540-226112562 GACTGTGTAGAGTTGGAAGAGGG - Intergenic
922770552 1:228180295-228180317 GGGAAGCTGGAGATGGAAGAAGG + Exonic
923054455 1:230415433-230415455 GAGTAACCAGATAGGGAAGAAGG - Intronic
923883488 1:238129757-238129779 GAGCAACTTGATATGGAAGAAGG - Intergenic
924103264 1:240625701-240625723 GAGTATTTACAGATAGAACATGG + Intergenic
924439833 1:244077004-244077026 GAGTAGCGACAGATGGCAGAAGG - Intergenic
924748461 1:246861150-246861172 GAGCATCAAGAAATGGATGAGGG - Exonic
1063582642 10:7322668-7322690 GGGTATGTTGAAATGGAAGAGGG + Intronic
1063827550 10:9915006-9915028 GAGTAGCTGGAAATGAAAGAGGG + Intergenic
1064823155 10:19362597-19362619 GAGAAACTAAAGCTGGAAGAAGG + Intronic
1068995179 10:63194197-63194219 GAGTATCTAGAAATATAACAGGG - Intronic
1071590316 10:86866196-86866218 CAGAATCTATAGATAGAAGAGGG + Intronic
1072788752 10:98302436-98302458 GAGGTTTTGGAGATGGAAGATGG - Intergenic
1072868783 10:99093858-99093880 GATTATCTAGAGATGGACACAGG - Intronic
1073378196 10:103055161-103055183 GAGCATCTGGGGATGGGAGAAGG - Intronic
1074654712 10:115572028-115572050 GACTACCTAGAGATGGATGTTGG + Intronic
1075534169 10:123256180-123256202 GAGTATTTAGCGTTGGGAGAAGG + Intergenic
1075742511 10:124704507-124704529 GAGTAGCCAGAGAAGGAAGGAGG + Intronic
1078918304 11:15801683-15801705 GAGTATATAAAGATGGATGCTGG + Intergenic
1079170247 11:18086865-18086887 GAGTATCTAAAGATAGAAAAAGG - Exonic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1080230032 11:30010829-30010851 GAGTATCTAGAGATGGAAGAAGG - Exonic
1080371715 11:31654810-31654832 CTGTATCTAGAGATGGGAGCAGG + Intronic
1080539005 11:33248784-33248806 GAATATAAAGAGAGGGAAGAAGG + Intergenic
1084069539 11:66725383-66725405 GGGAATCTAGAGATGGCAGCAGG - Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1088566998 11:111183043-111183065 GAGCTTCTAGACATGGAGGAAGG - Intergenic
1089151338 11:116366726-116366748 GAGGGTCTTGAGTTGGAAGAAGG - Intergenic
1089221277 11:116873882-116873904 AGGTACCTAGACATGGAAGAGGG - Exonic
1090303728 11:125672097-125672119 GAGTGTGTAGGGATGGAAAAGGG + Exonic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091351344 11:134899094-134899116 GAGCATCTAGAGATAGAAATAGG - Intergenic
1094349655 12:29509819-29509841 AAGTGTCTAGAGATTAAAGAAGG - Intronic
1094776587 12:33736474-33736496 AAGTTTCTAGAGATGGATGTTGG - Intergenic
1096898874 12:54853624-54853646 GAGAGTTTAGAGATGGAAAATGG - Intronic
1097716102 12:62967955-62967977 GTGGATCTAGAGTTGGGAGAAGG + Intergenic
1098499470 12:71174007-71174029 GAATTTCTAGAGAGAGAAGATGG + Intronic
1099581691 12:84455863-84455885 GAGGAGCTGGAGATGGAAGAAGG - Intergenic
1100359869 12:93866816-93866838 GGGAACCTAGTGATGGAAGAGGG + Intronic
1102657819 12:114497761-114497783 GAGAAGCTTGAGAGGGAAGAGGG - Intergenic
1103147221 12:118605545-118605567 CAGCATCTAAAGATGGCAGAAGG - Intergenic
1104034744 12:125090501-125090523 GTGGATGGAGAGATGGAAGATGG - Intronic
1104527010 12:129533272-129533294 GAGTATCTAGAAAGGTCAGATGG - Intronic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1106893814 13:34276100-34276122 GAGTATTAAGAAATGGAAGTAGG - Intergenic
1110246605 13:73332400-73332422 GGTTGTCTAGAGATGGGAGAGGG - Intergenic
1110980218 13:81888913-81888935 AAATATCTAGAGATTGAAGGTGG + Intergenic
1112370844 13:98792076-98792098 GAGTATCTGGAGATGGAGGGTGG + Intergenic
1113574105 13:111382281-111382303 GGGTCTGTAGAGATGGTAGAGGG + Intergenic
1115344193 14:32324794-32324816 GAGAATGCAGAGATGGAAAAAGG + Intergenic
1116610613 14:47066715-47066737 GATAATCTGAAGATGGAAGAAGG + Intronic
1117050479 14:51854952-51854974 GAGTAGATGGAGATTGAAGAAGG - Intronic
1119469250 14:74883466-74883488 GAGTGGCAAGAGATAGAAGATGG + Intronic
1120111085 14:80557752-80557774 GAGTATGAAGAGAGGAAAGATGG - Intronic
1121647331 14:95527885-95527907 GTCTATCTGGAGAGGGAAGAAGG + Intergenic
1125063473 15:35453276-35453298 GTGTATATATATATGGAAGAAGG - Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1131066791 15:89439711-89439733 GGGTAGATAGAGAAGGAAGAGGG - Intergenic
1131127849 15:89870388-89870410 AAGTATCTAAAGAAGGAAAAGGG + Intronic
1131998373 15:98155243-98155265 GAGTGTCTGGAGAGGAAAGAGGG + Intergenic
1135803047 16:25517081-25517103 GAGAATCGAGAGATGGTAGAAGG + Intergenic
1136469943 16:30473468-30473490 GAGTAGCTAGAGCTGGGAGGAGG + Intronic
1141382888 16:83591612-83591634 GAGAATTCAGAGAAGGAAGAAGG - Intronic
1143447528 17:7018212-7018234 GAGTTCCTACAGAGGGAAGATGG - Intergenic
1144464785 17:15488615-15488637 GAGTTTCTACAGGTGGAGGAGGG - Intronic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1150844782 17:68644425-68644447 GAGTGTCTAGAGATGGAAAGAGG - Intergenic
1150958590 17:69889827-69889849 GAGGATGTAGTGATGCAAGAGGG + Intergenic
1151264400 17:72943112-72943134 GAGTGTCTTGAGGTGGAAGAAGG + Intronic
1153229814 18:2924981-2925003 GACTCTCAAGAGATGGAGGAAGG + Intronic
1153235939 18:2987749-2987771 TCGTTTCTATAGATGGAAGAAGG - Intronic
1153353781 18:4112001-4112023 TAGCATCTTAAGATGGAAGATGG + Intronic
1154047487 18:10920653-10920675 GAGTATTTAGAGACACAAGACGG + Intronic
1154173303 18:12066553-12066575 GAGTATTTAGAGACACAAGATGG - Intergenic
1154262752 18:12851749-12851771 GAGTTACTAGAGGGGGAAGAAGG - Intronic
1155758661 18:29536145-29536167 GAGAAACTAGAGATGTAAGTCGG - Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1157079682 18:44509374-44509396 GTGTATCTTGAATTGGAAGATGG + Intergenic
1158923723 18:62227456-62227478 GAGTTTCAAGAGTTGGAGGAAGG - Exonic
1159375046 18:67582296-67582318 GAATATCTAGAAATGGAGGTTGG + Intergenic
1160752851 19:742794-742816 AACTGTCTACAGATGGAAGAAGG - Intronic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1162380800 19:10330554-10330576 GAGTTACTGGAGATGGAAGGGGG + Intronic
1164509701 19:28887353-28887375 GAATATCTAGAGGTGGACGTAGG + Intergenic
1165558213 19:36654788-36654810 GAGGAGGTAGAGATGGCAGAGGG - Intronic
1167771533 19:51523164-51523186 GAATTTCTAGAGATGAAAAATGG + Intronic
1168192229 19:54747498-54747520 GAGTATCTGGAGTTCGGAGATGG - Intronic
1168194506 19:54764054-54764076 GAGTATCTGGAGTTTGGAGATGG - Intronic
1168196556 19:54778775-54778797 GAGTATCTGGAGTTCGGAGATGG - Intronic
1168204917 19:54843031-54843053 GAGTATCTGGAGTTCGGAGATGG - Intronic
1168653496 19:58109867-58109889 GAGAATATAAAGATGGATGAAGG + Intronic
925389151 2:3483698-3483720 GAGCACCCAGAGATGGAGGAAGG + Intronic
925893249 2:8452824-8452846 AAGATTCTAGAGATGGGAGAAGG - Intergenic
926367310 2:12145114-12145136 GAGTCAGTAGAGATGGAAGAAGG + Intergenic
927305100 2:21562240-21562262 GAGAAGCCAGAGATGGAGGAAGG + Intergenic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
928411001 2:31053671-31053693 GAGAATCTAGTAATGGAAGCAGG - Intronic
929862313 2:45689947-45689969 TAGTCTCTAGAGAGGGAAGTGGG - Intronic
934926358 2:98384309-98384331 TAGTATCTGGTGATGGAAAAAGG - Intronic
935079529 2:99778516-99778538 GAGCATCTAGAGATGGGAGTGGG - Intronic
935504689 2:103885551-103885573 CAGTATCTAGAGAGGTAAAAGGG + Intergenic
937029159 2:118723792-118723814 GAGTAGCTGGAGATAGAACAAGG + Intergenic
937777748 2:125800220-125800242 GAGTATGTTGAGAAGGAAGAGGG - Intergenic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
940114338 2:150191872-150191894 GAGTAAGGAGAGATGGAAGTGGG + Intergenic
941595646 2:167473675-167473697 CACAATCAAGAGATGGAAGAAGG + Intergenic
941640474 2:167982642-167982664 GAGAATCTAGAGGTGACAGATGG - Intronic
941641664 2:167995601-167995623 GAGTATCAAGAGAGAGAAGATGG + Intronic
942839309 2:180340388-180340410 GAGTATGCAAAGATGGTAGAGGG + Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943264468 2:185710019-185710041 GCTTATCTAGATATGTAAGAGGG - Intergenic
943644722 2:190397905-190397927 GAGGTTCTAGAGATGGAAAGTGG + Intergenic
944068776 2:195647046-195647068 GAGACTCTAAAAATGGAAGAGGG - Intronic
944117770 2:196207738-196207760 GAGTATCTATAGACGGGTGAGGG + Intronic
944824637 2:203469195-203469217 GAGTAAATAGAGAACGAAGAGGG + Intronic
945600930 2:211864075-211864097 GAAAATCTAGAGATGGTAGTGGG - Intronic
948265832 2:236634764-236634786 GAGTACCTAGAGATGGCATTGGG - Intergenic
948540317 2:238686664-238686686 GCATAGCTAGAGATGAAAGAAGG + Intergenic
1170397691 20:15945910-15945932 GTGTGTCTAGAGAAGGCAGAGGG + Intronic
1171175766 20:23049968-23049990 GAGGACCAAGAGATGAAAGAGGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1175849741 20:62083357-62083379 AAGCCTCTAGAGATGGATGATGG - Intergenic
1177356018 21:20008972-20008994 TGGTATCTGGAGATGGTAGAAGG + Intergenic
1177450685 21:21261266-21261288 GATGATCTAGAGATGTAAGTGGG - Intronic
1177580708 21:23018867-23018889 GTGGATCTAGAGATAGAATATGG - Intergenic
1178082674 21:29081097-29081119 CAGTATCTAGAAATACAAGAGGG + Intronic
1178874778 21:36405349-36405371 GAGTACTTAGAAATGGAAGGAGG + Intronic
1181122157 22:20678078-20678100 GAGAATCTAGAGAATGAAGGAGG + Intergenic
1182864945 22:33595967-33595989 GAGTTTCTAAATATGGAACAGGG + Intronic
1184016462 22:41789572-41789594 AAAGATCTAGAGATGGATGATGG - Intronic
951249648 3:20380132-20380154 AGGTTTCTAGAGATGGAAGGCGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952289056 3:31997688-31997710 GAACATCTGGAGATGGGAGATGG + Intronic
952995717 3:38880296-38880318 GAGTAAGTAAAAATGGAAGAAGG + Intronic
953505110 3:43478196-43478218 GAGGTTCTGGAGATGGAAGTTGG + Intronic
953532450 3:43750756-43750778 GATTATCTGGGGCTGGAAGAGGG - Intergenic
954827311 3:53385432-53385454 GTGTGTCTAGGGATGAAAGATGG + Intergenic
955398676 3:58575645-58575667 GACTATCTAGAGAGAGAAAAGGG - Intronic
955505234 3:59626171-59626193 GAAGTTCTAGAGATGGACGATGG - Intergenic
955609338 3:60740634-60740656 GATGTTCTAGAGATGGATGATGG - Intronic
956937497 3:74119917-74119939 AAGCTTCTAGAGATGAAAGAAGG + Intergenic
958120986 3:89287827-89287849 GAGAATCTTGAGTGGGAAGAAGG - Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961345320 3:126260216-126260238 GAAGATGTAGAGAGGGAAGAGGG - Intergenic
961560900 3:127729369-127729391 AACTATCTAGAGATGGATGATGG - Intronic
962400847 3:135057526-135057548 GACTCTATAGAGAGGGAAGAAGG - Intronic
964077156 3:152705852-152705874 CAGTTTCTAGAGATGGTAAAGGG - Intergenic
964204636 3:154159028-154159050 GAGTTTCTAAATATGGGAGAAGG - Intronic
965751060 3:171975461-171975483 GAGCAGCCAGAGATGGAGGAGGG + Intergenic
965836196 3:172855783-172855805 GAATAACTGGACATGGAAGAAGG + Intergenic
965916981 3:173861393-173861415 CAGAATCTAGAGCTGGGAGATGG + Intronic
966555448 3:181254417-181254439 GTGTATAAAGATATGGAAGAAGG + Intergenic
968475589 4:805261-805283 GATTATCTAAAGATAGAAGGAGG + Intronic
968974285 4:3812999-3813021 GAAGATCTGGAGACGGAAGAAGG + Intergenic
970122752 4:12775205-12775227 AAGTAGCTAGAGATGGAAGATGG - Intergenic
970328493 4:14954081-14954103 GAGTTACTTGAGATGAAAGAGGG - Intergenic
971072956 4:23115220-23115242 GATGAGCTAGAGATGGAAGCAGG - Intergenic
971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG + Intergenic
973083255 4:46022172-46022194 CATTTTCCAGAGATGGAAGAAGG - Intergenic
974081284 4:57215928-57215950 GTGACTGTAGAGATGGAAGAGGG - Intergenic
974616245 4:64286425-64286447 GAGAAGCTAGAGACAGAAGAAGG + Intronic
975280663 4:72558451-72558473 GAGTCTTTATAAATGGAAGAGGG - Intronic
975433467 4:74322438-74322460 TATTATCAAGTGATGGAAGAGGG + Intergenic
975925657 4:79448589-79448611 TAGTGTCTAGTGATGGAACAGGG + Intergenic
978737362 4:112099119-112099141 GAGTATCTGGAGTTTTAAGAAGG + Intergenic
979829732 4:125284761-125284783 GAGAATCTGGAGATGGCAGGGGG - Intergenic
980618459 4:135265799-135265821 GAGTATCCAGAGGTGGTAAAGGG - Intergenic
981800489 4:148649401-148649423 GATTATCTTGAGATGGGACAGGG + Intergenic
981833492 4:149028558-149028580 CAGTATCTAGAGTTGGGGGAGGG + Intergenic
982429901 4:155310911-155310933 CAGTAACTAGAGAGAGAAGAGGG + Intergenic
982519002 4:156389515-156389537 GAGTCTTTAGAATTGGAAGAAGG - Intergenic
983468738 4:168128894-168128916 AAGTATATAGAGAGAGAAGAAGG + Intronic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984462184 4:180052409-180052431 AAATATCTAGAGATGGATGGTGG + Intergenic
984944113 4:184957872-184957894 GAGGATCTGGAGAAGCAAGAAGG + Intergenic
986185735 5:5435504-5435526 AAGTATTTAGTGATGGAAAAAGG + Intronic
986285269 5:6354367-6354389 GAGGGTCTGGACATGGAAGAAGG + Intergenic
986776773 5:11022633-11022655 GAGAATCAAGAGAAGGAAAATGG - Intronic
987582045 5:19806578-19806600 AAGTATCTAGAAACCGAAGAAGG - Intronic
987772788 5:22328655-22328677 GTGTCTCTAAAGATGTAAGAAGG + Intronic
989961808 5:50424941-50424963 GAGAAAGTAAAGATGGAAGAGGG - Intronic
990666234 5:58075563-58075585 GAGGATCTATATTTGGAAGAAGG + Intergenic
990919029 5:60942612-60942634 TAGTTTCTAGAGAAGGAAGAGGG + Intronic
991140876 5:63240959-63240981 AAGTCTCTAGAAATGGAAGGAGG + Intergenic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991674336 5:69076252-69076274 GAGTGTCTGGAGAAGGAAGCAGG - Intergenic
992566386 5:77999032-77999054 GAGTTTCTAGGCATGGGAGAAGG - Intergenic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
995082176 5:108065034-108065056 GAGCTTCTAGGGATAGAAGAGGG - Intronic
996480132 5:123966679-123966701 GAGTATCCTGAGGTGGAAGATGG - Intergenic
997349097 5:133217423-133217445 GAGTACCTAGAGATGTTGGAGGG - Intronic
997993793 5:138569128-138569150 GAGTCTCTTGGGGTGGAAGATGG - Intronic
998234404 5:140385824-140385846 GAGGATCTAGTGAAGGAACATGG - Intergenic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
1000291275 5:159873742-159873764 CACTGTCTAGAGATGGAAGGAGG - Intergenic
1000850561 5:166334998-166335020 GAGTATGAAGAGAAGAAAGAAGG + Intergenic
1002072719 5:176689873-176689895 GAGTCCTTAGAGATGGAAGAGGG - Intergenic
1002123133 5:177021475-177021497 GAGTAGCCAGAGAAGGAAGTGGG + Intronic
1010318834 6:74483202-74483224 GAATATGTAGAGAGGGAGGAAGG - Intergenic
1010939752 6:81902639-81902661 GAAAATATAGAGATGAAAGATGG + Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012114876 6:95284478-95284500 GTGTATCTAAACATGGAAAAGGG - Intergenic
1012599382 6:101075821-101075843 GAGTTTTTATTGATGGAAGATGG - Intergenic
1012643312 6:101649950-101649972 GAAGATCTAGAGATGGAAAAAGG - Intronic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1013696692 6:112710744-112710766 AAGTTTCTAGAAATGGAAGAAGG + Intergenic
1014141385 6:117947337-117947359 GAGATTCTAGAGATGAAAGGAGG + Intronic
1015659503 6:135559388-135559410 AAAGTTCTAGAGATGGAAGATGG + Intergenic
1016474217 6:144408846-144408868 GAATATCTAGAGGTGGAAAAGGG - Intronic
1016620137 6:146099445-146099467 GAGTATCTACTGAGGGTAGAGGG + Intronic
1018719676 6:166563219-166563241 GTGTCTCTGGAGAAGGAAGATGG + Intronic
1018818770 6:167356443-167356465 GAGTATAAAGGGCTGGAAGATGG - Intronic
1020122529 7:5513263-5513285 GAGCATCCAGAGATAGAAGATGG + Intronic
1020999493 7:15310970-15310992 GTGTTTTTAGAAATGGAAGAGGG - Intronic
1022058053 7:26761199-26761221 GTGTAACTTGATATGGAAGAGGG - Intronic
1022188516 7:27994134-27994156 GAGATTCTAGAGCTTGAAGAAGG - Intronic
1022241987 7:28521330-28521352 GATTATCTGAAGTTGGAAGAGGG + Intronic
1022601881 7:31768620-31768642 GAGAAGCTATAGATGGAAGGCGG - Intronic
1023542629 7:41282709-41282731 GAGTATCTCAAGAGGGAACAGGG + Intergenic
1023542636 7:41282756-41282778 GAGTATCTCAAGAGGGAACAGGG + Intergenic
1027236381 7:76300610-76300632 GTGTTTCTAAAGATAGAAGATGG + Intergenic
1028917552 7:96276139-96276161 GTTTACCTAGAGAAGGAAGAAGG + Intronic
1029216458 7:98953954-98953976 GAGAAGCTTGAGATGGAAAAGGG - Intronic
1029957775 7:104657729-104657751 GAAGCTCCAGAGATGGAAGATGG - Intronic
1031923599 7:127618850-127618872 TAACATCTAAAGATGGAAGAAGG - Intergenic
1032343467 7:131097571-131097593 GAGCATAAAGAGATGGGAGAAGG + Intergenic
1034578258 7:152020360-152020382 GAGTATCTTCAGATGACAGAAGG - Intergenic
1035114357 7:156510341-156510363 AAGCAGCTAGAGATGTAAGAAGG + Intergenic
1037211430 8:16393034-16393056 AAGTATCTAAACATGGAAGAAGG - Intronic
1037675737 8:21049509-21049531 TAGAAACTAGAGATGGAGGAAGG + Intergenic
1038497087 8:28011128-28011150 CAGTAGCTAGTGATGGAGGAGGG + Intergenic
1039561413 8:38515156-38515178 GATTTTCTAGGGTTGGAAGAGGG - Intronic
1042650101 8:71031272-71031294 GATTTTCTATATATGGAAGAAGG - Intergenic
1043408930 8:79971553-79971575 AAGTATGTAGAGACAGAAGATGG - Intronic
1044482124 8:92703328-92703350 GAATATCTAAAGATGCAGGAGGG - Intergenic
1047684360 8:127289403-127289425 GAGGATCTAGAAATGGATGGAGG + Intergenic
1047718683 8:127619283-127619305 AAGTATCAAGAGCTTGAAGATGG + Intergenic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1052515894 9:29479076-29479098 GAGTATAGATAGATGGAAAAAGG - Intergenic
1053235743 9:36452365-36452387 GATTATCTAGGGCTGGAGGAGGG - Intronic
1057568600 9:96186183-96186205 GTGTATCTAAACATAGAAGAGGG - Intergenic
1058493758 9:105531540-105531562 TTGTAACTAGAGAAGGAAGATGG - Intronic
1061038299 9:128125554-128125576 GAGGAACTAGAGATGGAAGGGGG + Intronic
1062150595 9:135016795-135016817 GAGTAGGTAGAGTAGGAAGAGGG + Intergenic
1186714730 X:12239529-12239551 CATTATCTAGAGAAGGGAGAGGG + Intronic
1186907821 X:14130888-14130910 TAGAATCTTCAGATGGAAGATGG - Intergenic
1191870879 X:65743785-65743807 GAGTCATTAAAGATGGAAGAGGG + Intergenic
1192614783 X:72608375-72608397 CACTATCTGGAGTTGGAAGAGGG + Intronic
1192844887 X:74896268-74896290 TGGTATCTAGATAAGGAAGAAGG - Intronic
1193706428 X:84825316-84825338 AAGTATCTAGAGGTGGAATGGGG + Intergenic
1195329900 X:103788339-103788361 GGATAATTAGAGATGGAAGAAGG + Intronic
1195349776 X:103985210-103985232 GATTATCTAGAGAAGGCAGCAGG - Intergenic
1195357667 X:104053629-104053651 GATTATCTAGAGAAGGCAGCAGG + Intergenic
1195558096 X:106250335-106250357 GAGTAACAACAGATGCAAGAAGG - Intergenic
1195599873 X:106734103-106734125 ATGTATCTAGAAATAGAAGATGG + Intronic
1196118799 X:112026122-112026144 GAGTTTCAAGAGTTGGAAGGAGG - Intronic
1197502490 X:127259463-127259485 GAGTTTCCAGAGGTGGAACAAGG + Intergenic
1197831836 X:130651285-130651307 GGGAATTTAGAGATGTAAGAGGG - Intronic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1200023057 X:153227835-153227857 GAATATGAAGTGATGGAAGATGG - Intergenic
1200803243 Y:7405901-7405923 ATGCATCTAGAGATGGATGAAGG + Intergenic