ID: 1080231116

View in Genome Browser
Species Human (GRCh38)
Location 11:30017944-30017966
Sequence CAGCCCACTTTTTTTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080231116_1080231118 -7 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231118 11:30017960-30017982 TGGGCTGTTCCTCGAAGTCAGGG No data
1080231116_1080231122 11 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231122 11:30017978-30018000 CAGGGTGTGGGTTTCTTTTACGG No data
1080231116_1080231124 26 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231124 11:30017993-30018015 TTTTACGGGCCTCTCCCGTAAGG No data
1080231116_1080231126 28 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231126 11:30017995-30018017 TTACGGGCCTCTCCCGTAAGGGG No data
1080231116_1080231123 12 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231123 11:30017979-30018001 AGGGTGTGGGTTTCTTTTACGGG No data
1080231116_1080231125 27 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231125 11:30017994-30018016 TTTACGGGCCTCTCCCGTAAGGG No data
1080231116_1080231120 -1 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231120 11:30017966-30017988 GTTCCTCGAAGTCAGGGTGTGGG No data
1080231116_1080231117 -8 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231117 11:30017959-30017981 GTGGGCTGTTCCTCGAAGTCAGG No data
1080231116_1080231119 -2 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231119 11:30017965-30017987 TGTTCCTCGAAGTCAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080231116 Original CRISPR CAGCCCACTTTTTTTTTTCT TGG (reversed) Intergenic
No off target data available for this crispr