ID: 1080231118

View in Genome Browser
Species Human (GRCh38)
Location 11:30017960-30017982
Sequence TGGGCTGTTCCTCGAAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080231116_1080231118 -7 Left 1080231116 11:30017944-30017966 CCAAGAAAAAAAAAAGTGGGCTG No data
Right 1080231118 11:30017960-30017982 TGGGCTGTTCCTCGAAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080231118 Original CRISPR TGGGCTGTTCCTCGAAGTCA GGG Intergenic
No off target data available for this crispr