ID: 1080231165

View in Genome Browser
Species Human (GRCh38)
Location 11:30018290-30018312
Sequence CTGGAGTTACAGTTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080231160_1080231165 30 Left 1080231160 11:30018237-30018259 CCTAAAGCCGAAACTTCTGGTTA No data
Right 1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG No data
1080231161_1080231165 23 Left 1080231161 11:30018244-30018266 CCGAAACTTCTGGTTAATAGCTT No data
Right 1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080231165 Original CRISPR CTGGAGTTACAGTTTGAGGA AGG Intergenic
No off target data available for this crispr