ID: 1080234867

View in Genome Browser
Species Human (GRCh38)
Location 11:30056911-30056933
Sequence GCGCCGTTTTTTAAGCTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080234862_1080234867 8 Left 1080234862 11:30056880-30056902 CCCAGCCAGGTGTGGGATATAAT 0: 283
1: 1216
2: 1217
3: 743
4: 519
Right 1080234867 11:30056911-30056933 GCGCCGTTTTTTAAGCTGGTCGG No data
1080234860_1080234867 12 Left 1080234860 11:30056876-30056898 CCCTCCCAGCCAGGTGTGGGATA 0: 17
1: 591
2: 1440
3: 1507
4: 1435
Right 1080234867 11:30056911-30056933 GCGCCGTTTTTTAAGCTGGTCGG No data
1080234856_1080234867 26 Left 1080234856 11:30056862-30056884 CCGTGGGCGTAGGACCCTCCCAG 0: 36
1: 1146
2: 1626
3: 1132
4: 875
Right 1080234867 11:30056911-30056933 GCGCCGTTTTTTAAGCTGGTCGG No data
1080234861_1080234867 11 Left 1080234861 11:30056877-30056899 CCTCCCAGCCAGGTGTGGGATAT 0: 17
1: 599
2: 1443
3: 1505
4: 1450
Right 1080234867 11:30056911-30056933 GCGCCGTTTTTTAAGCTGGTCGG No data
1080234863_1080234867 7 Left 1080234863 11:30056881-30056903 CCAGCCAGGTGTGGGATATAATC No data
Right 1080234867 11:30056911-30056933 GCGCCGTTTTTTAAGCTGGTCGG No data
1080234864_1080234867 3 Left 1080234864 11:30056885-30056907 CCAGGTGTGGGATATAATCTCGT 0: 151
1: 1164
2: 1397
3: 1619
4: 1164
Right 1080234867 11:30056911-30056933 GCGCCGTTTTTTAAGCTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080234867 Original CRISPR GCGCCGTTTTTTAAGCTGGT CGG Intergenic
No off target data available for this crispr