ID: 1080240516

View in Genome Browser
Species Human (GRCh38)
Location 11:30122074-30122096
Sequence ATGCATTTTGATCTGCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080240511_1080240516 19 Left 1080240511 11:30122032-30122054 CCCTTTTAGGATCTTCTTGGCAT No data
Right 1080240516 11:30122074-30122096 ATGCATTTTGATCTGCTGTCTGG No data
1080240510_1080240516 20 Left 1080240510 11:30122031-30122053 CCCCTTTTAGGATCTTCTTGGCA No data
Right 1080240516 11:30122074-30122096 ATGCATTTTGATCTGCTGTCTGG No data
1080240512_1080240516 18 Left 1080240512 11:30122033-30122055 CCTTTTAGGATCTTCTTGGCATC No data
Right 1080240516 11:30122074-30122096 ATGCATTTTGATCTGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080240516 Original CRISPR ATGCATTTTGATCTGCTGTC TGG Intergenic
No off target data available for this crispr