ID: 1080241132

View in Genome Browser
Species Human (GRCh38)
Location 11:30128403-30128425
Sequence TGGGATCCCCCAAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080241125_1080241132 28 Left 1080241125 11:30128352-30128374 CCTTCTCACTGCTGACTCATTTT No data
Right 1080241132 11:30128403-30128425 TGGGATCCCCCAAAGGAGCAAGG No data
1080241129_1080241132 -10 Left 1080241129 11:30128390-30128412 CCAGACATCACCATGGGATCCCC No data
Right 1080241132 11:30128403-30128425 TGGGATCCCCCAAAGGAGCAAGG No data
1080241128_1080241132 -7 Left 1080241128 11:30128387-30128409 CCACCAGACATCACCATGGGATC No data
Right 1080241132 11:30128403-30128425 TGGGATCCCCCAAAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080241132 Original CRISPR TGGGATCCCCCAAAGGAGCA AGG Intergenic
No off target data available for this crispr