ID: 1080243022

View in Genome Browser
Species Human (GRCh38)
Location 11:30148788-30148810
Sequence AGCAAATGGGCATCCTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080243022_1080243026 -2 Left 1080243022 11:30148788-30148810 CCCTTTCAGGATGCCCATTTGCT No data
Right 1080243026 11:30148809-30148831 CTTGAGAGTAATGAATATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080243022 Original CRISPR AGCAAATGGGCATCCTGAAA GGG (reversed) Intergenic
No off target data available for this crispr