ID: 1080248041

View in Genome Browser
Species Human (GRCh38)
Location 11:30201591-30201613
Sequence TCAAAGGGCTTGAGAACCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080248041_1080248047 7 Left 1080248041 11:30201591-30201613 CCCCTGGTTCTCAAGCCCTTTGA No data
Right 1080248047 11:30201621-30201643 TTGAATACCACTGACCTTCCAGG No data
1080248041_1080248051 26 Left 1080248041 11:30201591-30201613 CCCCTGGTTCTCAAGCCCTTTGA No data
Right 1080248051 11:30201640-30201662 CAGGTTCTCCAGCTTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080248041 Original CRISPR TCAAAGGGCTTGAGAACCAG GGG (reversed) Intergenic
No off target data available for this crispr