ID: 1080250244

View in Genome Browser
Species Human (GRCh38)
Location 11:30225802-30225824
Sequence TGGGGTTTCCTCACAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080250236_1080250244 24 Left 1080250236 11:30225755-30225777 CCAGAAGCCAGAAGGTGAGACCA No data
Right 1080250244 11:30225802-30225824 TGGGGTTTCCTCACAAAAGCTGG No data
1080250238_1080250244 4 Left 1080250238 11:30225775-30225797 CCACCTAGCAGAAGCTCAAACCA No data
Right 1080250244 11:30225802-30225824 TGGGGTTTCCTCACAAAAGCTGG No data
1080250239_1080250244 1 Left 1080250239 11:30225778-30225800 CCTAGCAGAAGCTCAAACCACAG No data
Right 1080250244 11:30225802-30225824 TGGGGTTTCCTCACAAAAGCTGG No data
1080250237_1080250244 17 Left 1080250237 11:30225762-30225784 CCAGAAGGTGAGACCACCTAGCA No data
Right 1080250244 11:30225802-30225824 TGGGGTTTCCTCACAAAAGCTGG No data
1080250235_1080250244 25 Left 1080250235 11:30225754-30225776 CCCAGAAGCCAGAAGGTGAGACC No data
Right 1080250244 11:30225802-30225824 TGGGGTTTCCTCACAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080250244 Original CRISPR TGGGGTTTCCTCACAAAAGC TGG Intergenic
No off target data available for this crispr