ID: 1080258538

View in Genome Browser
Species Human (GRCh38)
Location 11:30321000-30321022
Sequence TCCACCTGGCCCTCTAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080258534_1080258538 11 Left 1080258534 11:30320966-30320988 CCTCTTCTTAATCATCTGCGTTA No data
Right 1080258538 11:30321000-30321022 TCCACCTGGCCCTCTAGCCCAGG No data
1080258532_1080258538 28 Left 1080258532 11:30320949-30320971 CCTCACTTGATGGAGGCCCTCTT No data
Right 1080258538 11:30321000-30321022 TCCACCTGGCCCTCTAGCCCAGG No data
1080258533_1080258538 12 Left 1080258533 11:30320965-30320987 CCCTCTTCTTAATCATCTGCGTT No data
Right 1080258538 11:30321000-30321022 TCCACCTGGCCCTCTAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080258538 Original CRISPR TCCACCTGGCCCTCTAGCCC AGG Intergenic
No off target data available for this crispr