ID: 1080259171

View in Genome Browser
Species Human (GRCh38)
Location 11:30327194-30327216
Sequence AAATAGGTATTCAACTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080259165_1080259171 30 Left 1080259165 11:30327141-30327163 CCACCTACTCAGAAGGCTGAGGT 0: 13
1: 1149
2: 20076
3: 128617
4: 229851
Right 1080259171 11:30327194-30327216 AAATAGGTATTCAACTTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 167
1080259170_1080259171 -10 Left 1080259170 11:30327181-30327203 CCAGGAATTTCAGAAATAGGTAT 0: 1
1: 0
2: 0
3: 24
4: 323
Right 1080259171 11:30327194-30327216 AAATAGGTATTCAACTTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 167
1080259166_1080259171 27 Left 1080259166 11:30327144-30327166 CCTACTCAGAAGGCTGAGGTGAG 0: 3
1: 46
2: 322
3: 820
4: 2510
Right 1080259171 11:30327194-30327216 AAATAGGTATTCAACTTCACTGG 0: 1
1: 0
2: 1
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080259171 Original CRISPR AAATAGGTATTCAACTTCAC TGG Intronic
902469725 1:16640357-16640379 GGAAAGGTATTCAACGTCACTGG + Intergenic
906898722 1:49809105-49809127 CAATCGGTTTTCAACTACACAGG + Intronic
910053964 1:83009242-83009264 AAATTTGTATTCAAATTCAAAGG - Intergenic
911456754 1:98134130-98134152 ACATGGATTTTCAACTTCACAGG - Intergenic
913029845 1:114890671-114890693 ACATAGGTACTCAACTTCTTTGG + Intronic
917230423 1:172830686-172830708 AGAAAGGTATTCAATTTCACTGG + Intergenic
917583387 1:176398627-176398649 GAAAAGGTCTTCAACATCACTGG - Intergenic
920985336 1:210883709-210883731 AAAGAGCTATACAAATTCACAGG + Intronic
921396164 1:214672015-214672037 AAATAAGTATTCACATTGACTGG - Intergenic
1063797524 10:9529352-9529374 CAAAAGCTATTCAAGTTCACAGG - Intergenic
1067112611 10:43410870-43410892 AGATAGGTATTCAGCATCATAGG + Intergenic
1073819987 10:107251019-107251041 AGATAGGAATTCAACCTCATTGG - Intergenic
1077436700 11:2543068-2543090 GAAAAGATATTCAACATCACTGG - Intronic
1078803856 11:14676079-14676101 AAAAAGGCATTCAACATCACAGG - Intronic
1080259171 11:30327194-30327216 AAATAGGTATTCAACTTCACTGG + Intronic
1080954534 11:37078046-37078068 AAATAGAGATGAAACTTCACTGG + Intergenic
1082105051 11:48212521-48212543 AAATAAGCATTTAACTGCACTGG - Intergenic
1086068727 11:82775449-82775471 GAAAAGATATTCAACTTCATTGG + Intergenic
1088704164 11:112446786-112446808 ATATAAGTTTTCAACTTCTCTGG + Intergenic
1093083889 12:14845302-14845324 AAAAAGTTATTAAACTTCACAGG - Intronic
1094122548 12:26989459-26989481 ACACAGGTTTTCAACTGCACAGG + Intronic
1094271073 12:28615718-28615740 AAATATGTATTACACTGCACTGG + Intergenic
1095163758 12:38947460-38947482 AAAAAGGTGTTCAACATCATTGG + Intergenic
1098449757 12:70607095-70607117 AAGTAGGTATTCAAGTCCAGAGG - Intronic
1098490457 12:71070147-71070169 AAATAGTTATTAAAGTTCACAGG + Intronic
1098511363 12:71317848-71317870 AAACAGGTATTCAAATTGAAAGG + Intronic
1100668159 12:96778432-96778454 AAATAATTCTTCAACTTGACTGG + Intronic
1101895119 12:108750731-108750753 AATCAGATATTCAACCTCACAGG + Intergenic
1105459313 13:20568703-20568725 AAAAAGGTATTAAAAGTCACTGG - Intronic
1105643410 13:22289843-22289865 AAAAAGGTATTCAAATTGAAAGG - Intergenic
1106277070 13:28220375-28220397 AAATAGTTACTCAACTTACCTGG - Exonic
1106928575 13:34639011-34639033 CAAAAGGTATTCAAATTCAAAGG + Intergenic
1106971108 13:35142917-35142939 AAATAGGTATACTACCTCACAGG + Intronic
1107539347 13:41371745-41371767 ACATAGATTTTCAACTGCACTGG + Intronic
1107590200 13:41896657-41896679 AAATATATATTCAACTTCACTGG + Intronic
1110011464 13:70339794-70339816 AAATAGGCTTTCCACTTGACAGG - Intergenic
1112903190 13:104384728-104384750 AAATATATTTTCATCTTCACGGG + Intergenic
1114373513 14:22116728-22116750 AAATATGAGTTCAACTCCACTGG - Intergenic
1119817846 14:77586799-77586821 AAAAAGCTGTTCAGCTTCACTGG + Intronic
1126074120 15:44892261-44892283 ACCTAGGAATCCAACTTCACAGG - Intergenic
1127039963 15:54963759-54963781 AAATAGCTATTAAACTCCAGAGG - Intergenic
1128848209 15:70921075-70921097 AAAGATCTATTCAACTGCACAGG - Intronic
1131582875 15:93662405-93662427 AAATAGGGATTCAACAGCATGGG + Intergenic
1132436753 15:101812112-101812134 AAATAGCTAATTAACTGCACTGG - Intronic
1135190167 16:20348222-20348244 AAACAGGACTTCAACATCACTGG - Exonic
1137517446 16:49159674-49159696 AAATAGAGATTGAACTTAACAGG + Intergenic
1139068743 16:63354015-63354037 TTATAGGTATTCAACAACACAGG + Intergenic
1141273986 16:82568429-82568451 AAATAGTTATTCATCATCACCGG + Intergenic
1141349222 16:83277262-83277284 AAATATGTTTTCACCTTCTCAGG + Intronic
1141611957 16:85186937-85186959 AAAGAGGAAGTCAACTTCCCTGG - Intergenic
1147019303 17:37518516-37518538 ATAAATGTATTCTACTTCACAGG + Exonic
1149215011 17:54344527-54344549 AAATATGTACTCAAACTCACCGG + Intergenic
1151528663 17:74689548-74689570 AAATTCTTATTCAATTTCACAGG - Intronic
1153331621 18:3880187-3880209 AATTAGGTATTGCACTTTACAGG + Intronic
1153966557 18:10188184-10188206 TAATAGGTTTTCAAATTTACTGG - Intergenic
1155411535 18:25550940-25550962 GAAAAGATATTCAACATCACTGG - Intergenic
1162870882 19:13585780-13585802 ACATAGATGTTCAAGTTCACAGG + Intronic
1164288306 19:23842127-23842149 AAATACGTATTCTAATTCAAGGG - Intergenic
1168599651 19:57707645-57707667 GAATAGGTACCCAACTTCTCAGG + Intronic
926854484 2:17239332-17239354 AAATAGTACTACAACTTCACTGG + Intergenic
927629257 2:24757295-24757317 AAAAATGTATGCCACTTCACTGG + Intronic
930532253 2:52603760-52603782 AAATTGGTATTCAAATTCTGTGG - Intergenic
932684201 2:73854121-73854143 ATAGAGGGATTCATCTTCACAGG + Intronic
932924140 2:75951860-75951882 AAATAGGTAATAAAATTAACCGG - Intergenic
935420188 2:102859526-102859548 AAATAGGTCTGCAACATCACTGG - Intergenic
938719223 2:134051007-134051029 ACATAAGTTTTCAACTTCTCTGG - Intergenic
939840115 2:147176600-147176622 AAATTGGCATTCAAGTTCAGAGG - Intergenic
941047041 2:160688202-160688224 AAATAGCTGCTCAACTTCACTGG - Intergenic
941225644 2:162843673-162843695 AGAAAGGTATTTAACTTCTCTGG - Intergenic
943719399 2:191187704-191187726 AAAAAGATATTCAACCTCGCTGG - Intergenic
944392668 2:199233705-199233727 AAATAAGTTTTCAACTCAACTGG + Intergenic
944870737 2:203909191-203909213 AAATATGTATTCCCCTTTACAGG - Intergenic
947680573 2:232028203-232028225 AAATAGATAATGAACTTCCCTGG - Intronic
1173425717 20:42941708-42941730 AGATGGGACTTCAACTTCACAGG + Intronic
1173689597 20:44950136-44950158 AAGTAGGGCTTCAGCTTCACTGG + Intronic
951299665 3:20979472-20979494 AAATAGTTGTTAAACTTCACTGG - Intergenic
951314355 3:21170288-21170310 AATTAGGTACGCAAATTCACTGG - Intergenic
951626263 3:24667156-24667178 ATATACGTATTCAACTTTAGTGG + Intergenic
952535262 3:34302709-34302731 AAAAAGGTGCTCAACTTTACTGG - Intergenic
952646114 3:35661077-35661099 TAATAGTTTATCAACTTCACTGG + Intronic
953944101 3:47130702-47130724 AAACAAGTATTTAACTCCACAGG + Intronic
955583512 3:60450820-60450842 AAATTGGTATATACCTTCACTGG - Intronic
956553624 3:70491834-70491856 AAATAGGTATTAGTGTTCACTGG - Intergenic
957760607 3:84550275-84550297 AAATAAAAATTCAACATCACTGG - Intergenic
959781338 3:110237459-110237481 AAATAGGTTTTTAACTACAAAGG + Intergenic
960420411 3:117438481-117438503 AAATAAATATTCACCTCCACAGG + Intergenic
960756096 3:121014625-121014647 AAATATATATTTAACTTCATAGG + Intronic
961427207 3:126857651-126857673 ATATAGGATTTCCACTTCACAGG + Intronic
964505350 3:157392918-157392940 AAATAGCTATTCTATTTCTCAGG + Intronic
964593569 3:158395570-158395592 AAAAATGTGCTCAACTTCACTGG + Intronic
964997646 3:162905597-162905619 AACAAGGTATTGAACATCACTGG + Intergenic
965356457 3:167680200-167680222 TTGTAGGTATCCAACTTCACTGG - Intergenic
965490862 3:169334166-169334188 AAATAGTTATGCAAATTGACTGG - Intronic
965895056 3:173565434-173565456 AAATAGGAATTCAACAGCATAGG - Intronic
967112943 3:186311284-186311306 CAATAAGTATTCAAGTTCAGGGG - Intronic
967780375 3:193432397-193432419 AAATAAGTTTTCATTTTCACTGG - Intronic
968198952 3:196735626-196735648 AAATAGGTATGAAACTATACTGG - Intronic
969958729 4:10920142-10920164 AAATAAGTTTTCAACTTCTTTGG - Intergenic
972007000 4:34121926-34121948 AAATACATAGTCAACTTCATTGG + Intergenic
973224339 4:47765761-47765783 GAAAAGGTGCTCAACTTCACTGG - Intronic
975882651 4:78929057-78929079 AAATACGTATGAAACTTCCCTGG + Intronic
976683755 4:87787300-87787322 AAATAGGTCTTTAATTTCATTGG + Intergenic
978155682 4:105487158-105487180 AAACAGATATTTAACTTCATTGG + Intergenic
978980006 4:114932769-114932791 ATATAGGTATTTAACTTCCTTGG - Intronic
979496720 4:121392309-121392331 GAATGGGTATTGAACTTGACAGG + Intergenic
980268887 4:130558035-130558057 AAAAAGGTGCTCAACATCACTGG + Intergenic
980938770 4:139252472-139252494 GAAAAGATATTCAACTTTACTGG - Intergenic
982741789 4:159064822-159064844 AAAAATCTATACAACTTCACAGG - Intergenic
983676503 4:170300536-170300558 GAAAAGGCATTCAACATCACTGG + Intergenic
983945465 4:173581701-173581723 AAATATGTATACAATTTCAGTGG - Intergenic
983961103 4:173756197-173756219 TAAAAGTTAATCAACTTCACTGG - Intergenic
984823085 4:183900940-183900962 ATATATGTATTTAACTTAACTGG - Intronic
985144685 4:186883703-186883725 AAAAAGATACTCAACTTCATTGG - Intergenic
986852789 5:11832551-11832573 AAAAAGATATTCAACATCAATGG + Intronic
987458853 5:18181892-18181914 TACTAGGAATTCAATTTCACTGG + Intergenic
988077935 5:26376781-26376803 AATTATGTAATCAACTTCATAGG - Intergenic
989092759 5:37751080-37751102 AATTAGATATTTAACTTCTCAGG - Intronic
989267858 5:39498295-39498317 CCATAGTTATTCAACTTGACAGG + Intergenic
990100257 5:52175993-52176015 AAAAAGGTAGTCAAATACACAGG - Intergenic
990810605 5:59718231-59718253 GAATAGGTAATCAAATTCATTGG - Intronic
992576128 5:78114903-78114925 AACAAGTTATTCAACTTCTCTGG + Intronic
993134202 5:83936829-83936851 AAATATGTTTTCATTTTCACTGG - Intergenic
994490097 5:100430710-100430732 AATCTGGTATTCATCTTCACGGG + Intergenic
995235386 5:109823493-109823515 AAAAATGTTTACAACTTCACTGG - Intronic
995418978 5:111941157-111941179 AAATAGGCATTCAATTGCAAAGG + Intronic
998308882 5:141106503-141106525 AAATTGGTATTTAAATTCTCTGG + Intronic
998717706 5:144905059-144905081 AAATAAGTATTCTAGTTTACAGG + Intergenic
998754981 5:145367918-145367940 AAATAAGTTTTCAACTTCTTTGG + Intergenic
999438985 5:151586594-151586616 AAATTGGTGTTCTACCTCACGGG + Intergenic
1002156779 5:177288194-177288216 AAAAAGGTACTCAAATTAACAGG - Intronic
1002837831 6:880393-880415 AAAGATGTTTTCAACTTCAGTGG + Intergenic
1005724658 6:28636640-28636662 ACATATGTTTTCAACTTCTCTGG + Intergenic
1007808634 6:44470425-44470447 AAAGAGTTCTTCAATTTCACTGG - Intergenic
1008019194 6:46556936-46556958 AAATAGTTATTATACTCCACAGG + Intronic
1008955460 6:57211544-57211566 AAATTGCTTTTCAACCTCACAGG + Intronic
1010364605 6:75034707-75034729 AAACAAGAATTCAACTTCATGGG + Intergenic
1010797214 6:80131429-80131451 ATATAATTATACAACTTCACTGG - Intronic
1011083533 6:83514153-83514175 AAATAGGTATGCTACTTTTCAGG - Intronic
1011556799 6:88577986-88578008 TAAAAGGTGTTCAACATCACTGG - Intergenic
1012647541 6:101705464-101705486 AACTGGGTATTGAACTTCACTGG + Intronic
1016623245 6:146136522-146136544 GAAAAGGTGTTCAACATCACTGG - Intronic
1018296492 6:162351394-162351416 TAAAAGGTATTCAATTTGACAGG - Intronic
1018555433 6:165045081-165045103 AAATACATATTCAACTTGCCTGG - Intergenic
1020865065 7:13549775-13549797 GACAAGGTATTCAACATCACTGG + Intergenic
1027296450 7:76777778-76777800 TAATATGTATTAAACTTCAATGG + Intergenic
1028824780 7:95258745-95258767 ACATAGACATTCAACTTCACTGG + Intronic
1028864899 7:95697469-95697491 ACTTAGGTTTTCAAATTCACTGG + Intergenic
1029351725 7:100017792-100017814 AGAGAGGTATTTAACTTCTCTGG - Intronic
1030626656 7:111852452-111852474 AAATAAGTATTTAAGTTCCCTGG - Intronic
1033270215 7:139924400-139924422 GAAAAGGTACTCAACATCACTGG - Intronic
1038510733 8:28132235-28132257 AAATAGGTAGTGATTTTCACAGG + Intronic
1041230283 8:55743536-55743558 AAATAGGTCCGTAACTTCACTGG + Intronic
1041404064 8:57477993-57478015 ACATAGGTATACAACTGCAATGG - Intergenic
1041527199 8:58820457-58820479 AAATAAGTGTACAACTTCTCAGG - Intronic
1041530541 8:58860849-58860871 AAAAAGGTATTCCAGTTCATAGG + Intronic
1043085104 8:75820037-75820059 AAAAATGTATTCAACTTAATTGG - Intergenic
1043584944 8:81758015-81758037 AAATAAATATTCCATTTCACTGG + Intronic
1043848952 8:85193682-85193704 AAAAGGGTATTCTAATTCACAGG - Intronic
1045974368 8:108114723-108114745 AAATAGGTATCCAAATATACTGG + Intergenic
1048776720 8:137954588-137954610 ACATACGTTTTCAACTGCACTGG - Intergenic
1050240598 9:3630502-3630524 AAATAGATATTTATTTTCACTGG - Intergenic
1050514848 9:6432579-6432601 AAATAGGAATTAAACTTCTTAGG + Intronic
1056337790 9:85592559-85592581 ATATACGTATTCAACTTTACAGG - Exonic
1058363982 9:104185690-104185712 AAATAGATATTGAAGTTCCCAGG - Intergenic
1058775441 9:108279061-108279083 AAATAAGATTTCTACTTCACAGG - Intergenic
1059546609 9:115182273-115182295 AATTAGGCATTCAAAGTCACAGG + Intronic
1059815123 9:117903523-117903545 AAATAGTTATTGAACCTCACTGG - Intergenic
1186895955 X:14004945-14004967 GAAAAGGTGTTCAACCTCACTGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1187588240 X:20687776-20687798 AAAAAGGTGCTCAACATCACAGG - Intergenic
1188071510 X:25724126-25724148 AAATGGCTATTCAACTCCAATGG - Intergenic
1188591823 X:31846000-31846022 AATTAGGTATTCGCCTCCACAGG + Intronic
1189747382 X:44183625-44183647 ACAAAGCTCTTCAACTTCACTGG + Intronic
1192205922 X:69096054-69096076 TAATATTTATTCATCTTCACGGG + Intergenic
1192402470 X:70850144-70850166 AAAAAGGAATTAAACTCCACAGG - Intronic
1192852719 X:74974695-74974717 GAAAAGGTGTTCAACATCACTGG - Intergenic
1193734751 X:85144179-85144201 AAATATGGAAACAACTTCACTGG - Intergenic
1195277809 X:103299401-103299423 ATATAGATAATCAACTTCCCAGG + Intergenic
1197484252 X:127027951-127027973 AAAAAGGTTCTCAACATCACTGG + Intergenic
1197651481 X:129069995-129070017 ATATAAGTTTTCAACTTCATTGG - Intergenic
1199439528 X:147852986-147853008 AAAAAGGTGCTCAACATCACTGG - Intergenic
1200739190 Y:6834685-6834707 AAATATGCATTCAAATTCTCTGG - Intergenic