ID: 1080262428

View in Genome Browser
Species Human (GRCh38)
Location 11:30364140-30364162
Sequence GTCACAGTGTGCAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080262428_1080262431 -2 Left 1080262428 11:30364140-30364162 CCTTGCTCTTTGCACACTGTGAC No data
Right 1080262431 11:30364161-30364183 ACCTGGGACCATTCACTTGCAGG No data
1080262428_1080262438 29 Left 1080262428 11:30364140-30364162 CCTTGCTCTTTGCACACTGTGAC No data
Right 1080262438 11:30364192-30364214 CCCACAACTAGCCAAGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080262428 Original CRISPR GTCACAGTGTGCAAAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr