ID: 1080265225

View in Genome Browser
Species Human (GRCh38)
Location 11:30393218-30393240
Sequence TCTATTAGGAAGGACACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080265225_1080265231 8 Left 1080265225 11:30393218-30393240 CCCTCTGTGTCCTTCCTAATAGA 0: 1
1: 0
2: 3
3: 23
4: 266
Right 1080265231 11:30393249-30393271 TCTCTGCTCTCACTACATCCTGG 0: 2
1: 0
2: 1
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080265225 Original CRISPR TCTATTAGGAAGGACACAGA GGG (reversed) Intronic
901526500 1:9825946-9825968 TCTAGTGGGAAGGACCCAGATGG + Intergenic
901906708 1:12418781-12418803 TCTATTATGAACTACAGAGAAGG + Intronic
904735785 1:32631750-32631772 TCAATGAGCAAGGAAACAGATGG - Intronic
904828898 1:33294366-33294388 GCTCTCAGGAAGGACACAGAGGG + Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906258119 1:44366157-44366179 TCCATTTGGAAGGACTCAGTGGG + Intergenic
907672370 1:56487177-56487199 TCTGTCAGGAAGGAGACACAGGG - Intergenic
907741378 1:57169580-57169602 GTTATGAGGAAGTACACAGAAGG - Intronic
908151310 1:61305641-61305663 TCCAATAGGATGGAAACAGAAGG + Intronic
909070854 1:70991861-70991883 TCTTTGAGCAAGGACACAAAAGG - Intronic
909429287 1:75568370-75568392 ACTCTTTGGAAGGACATAGATGG + Intronic
910134023 1:83944813-83944835 TCTATGCTGATGGACACAGAAGG + Intronic
910774136 1:90858041-90858063 CCTATTAGTAAAGACACACAAGG + Intergenic
912153774 1:106890462-106890484 TCTATTGGGGGGGTCACAGAGGG - Intergenic
913027089 1:114854598-114854620 AATCTTAGGAAGGAAACAGATGG - Intergenic
913500998 1:119472617-119472639 TCTATGAGGAAAGACCGAGATGG + Intergenic
914468547 1:147951482-147951504 TCTATTAAGGAGGAAATAGATGG + Intronic
917058233 1:171007354-171007376 CCTATTACCAAGTACACAGATGG + Intronic
917061459 1:171046048-171046070 ACTATAAGGAAGGACAAAGAAGG - Intronic
918311581 1:183289146-183289168 TCTGGCAGCAAGGACACAGATGG + Intronic
918900573 1:190411241-190411263 TTTATTAGGAAGAAAAAAGAAGG + Intronic
920893305 1:210016037-210016059 TCTACTAGAGAGGACACTGAAGG - Intronic
921624498 1:217363472-217363494 TCTAGTAGGAAGTTCTCAGATGG + Intergenic
921877134 1:220210489-220210511 TCTAGGAGGAAGCACAGAGAAGG + Exonic
924534986 1:244927880-244927902 TCTATCAGGAAGGAGAAAGACGG + Intergenic
1063296435 10:4811351-4811373 TCCATTAACAAGGACACTGATGG - Intronic
1063888992 10:10609615-10609637 TCTATTAGGAGGAACAGAGTTGG - Intergenic
1065977505 10:30855478-30855500 TCTATCAGGAAGTACATACAAGG + Intronic
1067551489 10:47239522-47239544 TCTGCTAGGCAAGACACAGATGG - Intergenic
1067856473 10:49797758-49797780 TGTATTAGATAGGACACAGGTGG + Intergenic
1068127801 10:52863252-52863274 TTTATTAGGTAGGTAACAGATGG + Intergenic
1069846504 10:71375750-71375772 ACATTTAGGAAGAACACAGACGG + Intergenic
1070500745 10:77070540-77070562 CCTATTAGGATGGACAAAGAAGG - Intronic
1072356682 10:94618347-94618369 TCTGTTAGGAAGGAAAAAGTAGG + Intergenic
1074650299 10:115515188-115515210 TCTATGAGGCAGGAAAAAGAGGG - Intronic
1074848056 10:117416245-117416267 CCTTATAGGAAGCACACAGATGG + Intergenic
1075233275 10:120702919-120702941 TCTCTGAGGAAGGACAAATAAGG + Intergenic
1076559427 10:131351442-131351464 TGGATTGGGAAGGACCCAGAAGG - Intergenic
1077709239 11:4519419-4519441 TCTGTGAGGAAGGACCTAGATGG + Intergenic
1078081392 11:8207104-8207126 TCTATTAGGGAATACATAGAGGG + Intergenic
1079931974 11:26574675-26574697 TCTATTAGGATAGAAATAGAGGG + Intronic
1080013258 11:27479099-27479121 TCTGGAATGAAGGACACAGAGGG + Intergenic
1080265225 11:30393218-30393240 TCTATTAGGAAGGACACAGAGGG - Intronic
1080721592 11:34854519-34854541 ATTATTATGAAGGACATAGAGGG + Intronic
1082222326 11:49654851-49654873 TAGAATAGGCAGGACACAGAGGG - Intergenic
1082939563 11:58689763-58689785 TTTATGAGGAAGCACACAGATGG + Intronic
1084414044 11:69020475-69020497 TGGCTTAGGAAGGACAGAGATGG - Intergenic
1084681961 11:70671635-70671657 TCCATAAGGAAGGACACCCAAGG - Intronic
1086994169 11:93337729-93337751 GTTATTAGGAAGGAGAGAGAGGG + Intronic
1087357889 11:97117923-97117945 TTTTTAAGGAAGTACACAGATGG + Intergenic
1087479170 11:98678373-98678395 ACTATTAAGAAGGGCAAAGAAGG - Intergenic
1089162283 11:116447835-116447857 TTTATAAGGAAGGGCACACAAGG + Intergenic
1091834318 12:3574903-3574925 TCTCTTGAGAAAGACACAGAAGG + Intronic
1092614606 12:10205356-10205378 TCAGTTAGGGAGGACACAAAAGG + Intergenic
1095736330 12:45560556-45560578 TCTATTTGGAAGGGTAAAGATGG - Intergenic
1098197263 12:68015250-68015272 TCTAAAAGTAAGGCCACAGAAGG + Intergenic
1098368951 12:69737604-69737626 TCTAACAGGAGGCACACAGATGG + Intergenic
1100763755 12:97839430-97839452 TTTACAAGGAAGTACACAGATGG + Intergenic
1100794766 12:98169923-98169945 TCTAATCTGAAGGACAGAGATGG + Intergenic
1100950379 12:99842434-99842456 TTTACAAGGAAGTACACAGATGG - Intronic
1101098430 12:101367929-101367951 TCTATGAGGAGAGACACAAAAGG - Exonic
1102550672 12:113689645-113689667 TCCAATAGGAAGGACCCTGATGG - Intergenic
1103507037 12:121448704-121448726 TCTAATAAACAGGACACAGAAGG + Intronic
1106343473 13:28853460-28853482 GCTATAAGGACTGACACAGATGG + Intronic
1106473128 13:30075808-30075830 CGGAGTAGGAAGGACACAGAGGG - Intergenic
1107816572 13:44249976-44249998 TCTATTTGGAAAGACACCCAAGG - Intergenic
1107858534 13:44638833-44638855 TCTATTAGTAAGGAGGAAGAAGG + Intergenic
1107963356 13:45578051-45578073 TTTATAAGGAAGTGCACAGATGG - Intronic
1108682258 13:52790418-52790440 TCTGGTAGGAAGGAAAAAGAAGG - Intergenic
1109859480 13:68178978-68179000 TCTTTTAGCAAAGAGACAGATGG + Intergenic
1110403891 13:75126930-75126952 TCTATAAGGAAGGAATAAGATGG + Intergenic
1110495738 13:76165563-76165585 TAGATTTGGAAAGACACAGAAGG + Intergenic
1110723750 13:78795640-78795662 TTAATTAGGAAGGACAAAGAAGG - Intergenic
1111749856 13:92315173-92315195 TATATTCGGAAGGTTACAGATGG + Intronic
1111962850 13:94830302-94830324 TCTATTCAGAAGGAAATAGAAGG + Intergenic
1113239395 13:108319663-108319685 ACTATCAGAAAGGACAAAGAGGG - Intergenic
1113341321 13:109429029-109429051 TCGTTTAGGAATGACTCAGAGGG - Intergenic
1114189968 14:20433311-20433333 CCTTTTAGGCAGGTCACAGAGGG + Intronic
1114353335 14:21879067-21879089 CATATTAGGCAGAACACAGATGG - Intergenic
1116757121 14:48961971-48961993 TCTGATAGGGAGGACAGAGATGG - Intergenic
1117626729 14:57647699-57647721 TTTATAAGGAAGAACACAGATGG - Intronic
1117844695 14:59898256-59898278 TCTAGTAGCAAGGTCACAAATGG + Intergenic
1119886921 14:78151247-78151269 TATAATAGGTGGGACACAGATGG - Intergenic
1120376825 14:83719252-83719274 TCTCCTTGTAAGGACACAGAAGG - Intergenic
1121684705 14:95827129-95827151 TCTATTAGAAAGGAGAAAGGTGG + Intergenic
1125992105 15:44119665-44119687 TCTCCTAGGAAGGATTCAGAAGG + Intronic
1127621665 15:60740049-60740071 TCTATTAGAAAGGAGAGAAAGGG + Intronic
1128629385 15:69248289-69248311 TCTATTAAGCAGTAAACAGATGG + Intronic
1130188544 15:81710627-81710649 GCTATTAGGAACAACACAGGTGG - Intergenic
1130196243 15:81782676-81782698 TTAAGTAGGAGGGACACAGAAGG + Intergenic
1131064940 15:89428516-89428538 TCTATTAGGAAGGAGAAAGAGGG + Intergenic
1131288930 15:91087965-91087987 GCTATGAGGCAGGGCACAGAAGG - Intergenic
1132562222 16:601316-601338 TCTAACAGGCTGGACACAGACGG - Intronic
1133251190 16:4482725-4482747 GATATTAAGAAGGATACAGATGG + Intronic
1133479480 16:6156166-6156188 TCTATTAGGAAAAACATAAAGGG - Intronic
1134123823 16:11602807-11602829 TCTAAAAGAAAGGACACAGGTGG + Intronic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1137844803 16:51676650-51676672 ACTATGCAGAAGGACACAGAAGG - Intergenic
1137918407 16:52458303-52458325 TCTGGTAGGGAGGAGACAGATGG + Intronic
1138274337 16:55721361-55721383 TCTATTAAGAAGGACAAAGAAGG + Intergenic
1139802534 16:69535150-69535172 TCTGTTGGGAAGGTCACACAGGG + Intergenic
1143851921 17:9819329-9819351 TTTATTAGGAAGATGACAGAGGG + Intronic
1143957455 17:10683165-10683187 TTTCTTCGGAAGGATACAGAAGG - Intronic
1143974358 17:10819279-10819301 TCAGTTAGGATGGAGACAGAGGG - Intergenic
1144566632 17:16364743-16364765 TTTATAAGGAAGTGCACAGATGG + Intergenic
1148885084 17:50766603-50766625 TCAATGAGAAAGTACACAGAAGG + Intergenic
1149018796 17:51939210-51939232 TCTATTAGTATGGACATGGAGGG - Intronic
1149544535 17:57493589-57493611 TCTAGTTGGAGGGACCCAGAGGG - Intronic
1149886815 17:60348332-60348354 TCCAAGAGGAAGGAAACAGAGGG + Intronic
1150274544 17:63887927-63887949 GCTTTTAGCAATGACACAGAAGG - Intergenic
1151885727 17:76922327-76922349 TCTGCAAGGAAGGATACAGAGGG + Intronic
1153327901 18:3840480-3840502 TCTTTTAAGAAGGAAGCAGAGGG - Intronic
1153500252 18:5741864-5741886 TCTATAGGGAAGGAAACACATGG - Intergenic
1155670660 18:28367088-28367110 TGGATTAGAAGGGACACAGAAGG + Intergenic
1155827426 18:30465420-30465442 ACTAATAAGAAGGACAAAGATGG + Intergenic
1155995845 18:32330807-32330829 TATATCAGGAAGGAAACAGAAGG + Intronic
1156047414 18:32892602-32892624 TATATTTGCAAGGCCACAGAAGG + Intergenic
1156212976 18:34967220-34967242 TATATTAGAAAGGATACAGATGG + Intergenic
1158006802 18:52681794-52681816 TCTGTTACGAATGGCACAGAGGG - Intronic
1159049598 18:63407485-63407507 TTTATTAGGAATGACAGTGATGG - Exonic
1159756209 18:72369623-72369645 TGTTTTAGGAAGGACCCAGTGGG + Intergenic
1159810315 18:73011574-73011596 TCTTCTAGTAATGACACAGAAGG + Intergenic
1160399233 18:78597807-78597829 TCTATTATGAACTACTCAGAAGG - Intergenic
1161209435 19:3058550-3058572 GCTGTTAGGAAGGACTAAGAGGG - Intronic
1162315305 19:9935147-9935169 TCTAGTAGGGAGGAGGCAGAGGG + Intronic
1164247578 19:23446657-23446679 TTTATAAGGAAAGACAAAGAGGG + Intergenic
1164265398 19:23611071-23611093 TATATTGGGAAGGGCCCAGATGG - Intronic
1167195483 19:48025364-48025386 TAAATTAGGAAGTAAACAGAGGG + Intergenic
1168188390 19:54717279-54717301 GCAATCAGGAAGGACAAAGAAGG + Intergenic
925874564 2:8300967-8300989 TGTTTTAGGAAGGAGATAGATGG - Intergenic
926630658 2:15133301-15133323 TCCATTTGGAAGGACATAGCGGG + Intergenic
926969139 2:18449327-18449349 TTTCTAAGGAAGGACACACAGGG - Intergenic
927827459 2:26318558-26318580 TCTATTGAGGAGAACACAGATGG + Intronic
927995672 2:27484036-27484058 CCTATAGGGAAGGACACAGCAGG + Intronic
929380095 2:41339137-41339159 TCTTTTAGGAAGGACAATAATGG + Intergenic
929415678 2:41744782-41744804 TGTCGTAGGAAGGACACAGTGGG + Intergenic
930073237 2:47385400-47385422 TCTATGAGGCAGAAAACAGATGG - Intronic
930273821 2:49288234-49288256 TTTATAAGGAAGTGCACAGATGG + Intergenic
930279775 2:49356296-49356318 ATTATTAGGAAGGACAAGGAAGG + Intergenic
930309910 2:49727015-49727037 TTTATTAGGGAGGGCAGAGAGGG - Intergenic
930400710 2:50881557-50881579 TCTATAAGAAAGGACACACAGGG + Intronic
930469394 2:51793655-51793677 TCTACTAGGCAGGACCCAGTGGG + Intergenic
933282885 2:80351975-80351997 TCTCTTTGCAGGGACACAGAGGG + Intronic
934719207 2:96561576-96561598 TCTGTTAGCAAGGACAAAGTGGG - Intergenic
934720755 2:96574549-96574571 TCTATTAGCAAAGACCCACAGGG - Intergenic
935390166 2:102542657-102542679 TTTATAAGGAAGTACACAAACGG + Intergenic
936257262 2:110927462-110927484 TCTATAAGAAAGGCCACAGCAGG - Intronic
937319242 2:120951198-120951220 TCTAAGAAGGAGGACACAGAGGG - Intronic
938182876 2:129199550-129199572 TTTACAAGGAAGTACACAGATGG - Intergenic
939486731 2:142822780-142822802 TCTATTATCAAAGAAACAGATGG - Intergenic
941984269 2:171494495-171494517 TCTATTACGCAGGAAACAAATGG + Intergenic
941985860 2:171511059-171511081 TATATTATGAAGGACATAAAAGG + Intergenic
944300172 2:198115037-198115059 TTTATAGGGAAGGGCACAGAAGG + Intronic
945847832 2:214968217-214968239 GTGATTTGGAAGGACACAGAGGG - Intronic
946494742 2:220184483-220184505 TTTACAAGGAAGTACACAGATGG - Intergenic
946676905 2:222169976-222169998 TCTATTAGAATGGAAAAAGAAGG + Intergenic
947619445 2:231580153-231580175 TGTATTATAAAGGACACAAATGG + Intergenic
948200344 2:236125496-236125518 TATATTAGAAAGGAAAAAGAAGG + Exonic
1169575304 20:6953251-6953273 TCTAGTATGAAGCACAGAGAAGG + Intergenic
1172968094 20:38853071-38853093 TCGATTAGAAAGGAAACAGTGGG - Intronic
1173447628 20:43134305-43134327 TTTACAAGGAAGTACACAGATGG - Intronic
1177125509 21:17188528-17188550 TCTAAAAGGAAGGACAAAGTTGG + Intergenic
1178633548 21:34282849-34282871 TCCATTCAGAAGGTCACAGAGGG + Intergenic
1184368705 22:44068992-44069014 CCTTTGAGGAAGGTCACAGAGGG - Intronic
1184926859 22:47648319-47648341 TTCATTAGGAAGAACACAGTGGG + Intergenic
949124205 3:426210-426232 ACTCTTAGGAATGGCACAGATGG + Intergenic
951256443 3:20454957-20454979 TCTATAAACAAAGACACAGATGG - Intergenic
951810801 3:26697409-26697431 TCTTATAAGAAGGATACAGAGGG - Intronic
952573847 3:34750079-34750101 ACAATCAGGAAGGACAAAGAAGG + Intergenic
956679941 3:71769095-71769117 TCTAGAGGGAAGCACACAGAGGG - Intergenic
956706936 3:72007228-72007250 TTTACAAGGAAGTACACAGATGG - Intergenic
957266820 3:77977560-77977582 TCTATTAGGAAGGAGAAAGTGGG + Intergenic
959047387 3:101489544-101489566 ACAATTAAGAAGGACAAAGATGG + Intronic
959842517 3:110994590-110994612 TTTACAAGGAAGTACACAGATGG + Intergenic
960856388 3:122106616-122106638 GCTGTTAGGAAGGACCCAGATGG + Intronic
962360935 3:134742282-134742304 TTTAGTGGGAAGGAAACAGAAGG - Intronic
962983756 3:140515219-140515241 TCCATTAGAAATGAAACAGAAGG - Intronic
963529183 3:146451930-146451952 TTTATTATAAAGGATACAGATGG - Intronic
963699114 3:148601644-148601666 TCTATTATAATGGGCACAGAGGG - Intergenic
964846977 3:161054840-161054862 TCTATATGGAAGGACACAAATGG - Intronic
965463117 3:168993457-168993479 TTTATGAGGAAGTGCACAGATGG - Intergenic
966549829 3:181192868-181192890 TCTATTGGGAATGAGAGAGATGG + Intergenic
968107925 3:196015485-196015507 TCTGTTAGGAAGGAGAAAGGTGG - Intergenic
971025937 4:22587982-22588004 GCTATTAGGAACAACACAGGTGG + Intergenic
973339361 4:48987624-48987646 TGTATAAGGAATGAGACAGATGG + Intronic
975057428 4:69951627-69951649 TTTACAAGGAAGTACACAGATGG - Intergenic
975436334 4:74356453-74356475 TCATCTAGGTAGGACACAGATGG + Intergenic
976492785 4:85691595-85691617 ACAATTAAGAAGGACAAAGAAGG - Intronic
978084031 4:104627808-104627830 TCTTTTAGGATGAACTCAGAGGG - Intergenic
979499510 4:121423122-121423144 TCAAGTAGGAATGACACAAAAGG - Intergenic
979689202 4:123542836-123542858 TTTATAAGGAAGTGCACAGATGG - Intergenic
980349944 4:131671043-131671065 TCTATCAGGAAGCACAAAGGTGG - Intergenic
981903096 4:149889679-149889701 TTTATAAGAAAGGGCACAGATGG - Intergenic
982022651 4:151219114-151219136 TTTACAAGGAAGTACACAGATGG - Intronic
982073298 4:151714605-151714627 TCTCTTGGCAAGGACCCAGATGG + Intronic
983131497 4:164024971-164024993 ACAATTAAGAAGGACAAAGAAGG + Intronic
984719880 4:182959631-182959653 TTTACAAGGAAGTACACAGATGG + Intergenic
984915239 4:184717725-184717747 TCTAGTGGGAAGGCCAAAGATGG + Intronic
985566170 5:618817-618839 TTTACAAGGAAGGGCACAGATGG + Intronic
986946109 5:13023006-13023028 TCTGTTAGAAACAACACAGATGG + Intergenic
988243146 5:28639698-28639720 TTTATAAGGAAGTTCACAGATGG + Intergenic
988898587 5:35706243-35706265 TCTTTTAGGATGGACACACTAGG + Intronic
988962351 5:36382897-36382919 TCTATTAAGAAGAAAAAAGAAGG - Intergenic
989202588 5:38779206-38779228 TCTATTAAAAAGTACATAGAGGG - Intergenic
990159671 5:52923871-52923893 TCCATGAAGAAGGACAGAGATGG - Intronic
991257809 5:64634344-64634366 TTTACAAGGAAGTACACAGATGG + Intergenic
991965078 5:72082711-72082733 TCTATTAGAAAGTAAAAAGATGG - Intergenic
992537923 5:77730263-77730285 TTTATTAGGGAAGACACATAAGG + Intronic
993173707 5:84454391-84454413 TTTACTAGTAAGGACACACATGG + Intergenic
993631600 5:90292931-90292953 GATATTGGGAAGAACACAGAAGG - Intergenic
994031361 5:95147456-95147478 ACTATCAAGAAGGACAAAGAAGG - Intronic
994798477 5:104338304-104338326 TGTGTTAGGAGGGACAAAGATGG - Intergenic
995356527 5:111243438-111243460 TGTACAAGGAAGCACACAGATGG + Intronic
995495931 5:112743218-112743240 TCTTTTAAGAAGGAGGCAGAAGG - Intronic
996357837 5:122616631-122616653 TTTATTAGGAAGTATACAGACGG - Intergenic
998477951 5:142437133-142437155 TCTAATAGGGAAGACAGAGATGG - Intergenic
1002272523 5:178082029-178082051 TGTATAAGGAAGCACACAGATGG - Intergenic
1003177717 6:3765069-3765091 TCTAATAGAAAGGCCACAGGAGG - Intergenic
1004765160 6:18718080-18718102 TGTCTTAGGAAGAACTCAGATGG + Intergenic
1005057414 6:21743177-21743199 TCTATTAGTGAAGACACAGAGGG + Intergenic
1005577637 6:27205084-27205106 TTTACAAGGAAGAACACAGATGG - Intergenic
1006010296 6:31037466-31037488 TCTCTTGGGAAGGGCACAGATGG - Intergenic
1006651316 6:35554164-35554186 TCCATTAGGATGGATAAAGAGGG - Intergenic
1008907210 6:56692395-56692417 TCTGTTTCTAAGGACACAGATGG - Intronic
1009466811 6:63981091-63981113 TCAAAGAGGTAGGACACAGAGGG - Intronic
1009794207 6:68445882-68445904 TCTATTACCAATGACTCAGAAGG + Intergenic
1010004814 6:70984095-70984117 TTTATAAGGAAGTGCACAGATGG + Intergenic
1010067587 6:71703004-71703026 CCTAGTAGGATGTACACAGATGG - Intergenic
1010427539 6:75743741-75743763 TTCATAAGGAAGGACACAGATGG + Intergenic
1010508827 6:76692147-76692169 TTTATAAGGAAGTGCACAGATGG + Intergenic
1011349635 6:86408344-86408366 TGTGTTTGGAAGGACACATATGG + Intergenic
1013922508 6:115424876-115424898 TCTATTAGGAAGGATTTGGAGGG + Intergenic
1014783952 6:125596877-125596899 TCTATTAGGTATGACAAAGATGG + Intergenic
1015706723 6:136096009-136096031 TTTTTCAGGAAGGAAACAGATGG - Intronic
1016569932 6:145500491-145500513 TCCACCAGCAAGGACACAGAGGG + Intergenic
1017265328 6:152439012-152439034 TATATGAGGAAGGACACATAAGG - Intronic
1020289185 7:6709795-6709817 TCAACTAGCAAGGACACAGGAGG + Intergenic
1021111654 7:16701515-16701537 TTTATTAGGAATGTCACATAGGG - Intronic
1022384984 7:29891460-29891482 TTTATTAGAAAGGGCACACAGGG - Intronic
1023743159 7:43299016-43299038 TCTATTAGTCTGGACATAGATGG + Intronic
1023762742 7:43482048-43482070 TGCATTAGGAAGCAGACAGATGG - Intronic
1024169035 7:46765206-46765228 GCCATAAGGAAGGACAGAGATGG + Intergenic
1026807300 7:73436303-73436325 TCCATTTGGAAGCACAGAGACGG - Intergenic
1026847528 7:73706196-73706218 TCTATCAGGAAGGCCCCGGATGG + Intronic
1027974114 7:85126945-85126967 CCTATTAGAAAATACACAGAAGG - Intronic
1028686614 7:93596831-93596853 TCTGATAGGAAGGACACAGATGG + Intronic
1029978645 7:104857817-104857839 TTTATTAGGAATTACACCGAGGG - Intronic
1030734574 7:113031541-113031563 TGTATTAGAAATGACACAGTGGG - Intergenic
1030785059 7:113650037-113650059 TCTACAAGGAAGTGCACAGATGG - Intergenic
1031243934 7:119282482-119282504 TATATTAGGAAGGAAAAAGGAGG - Intergenic
1031509790 7:122635858-122635880 ACAATCAGGAAGGACAAAGAAGG - Intronic
1033313510 7:140279634-140279656 TCATTTAGGAAGAACACACATGG - Intergenic
1033831429 7:145258464-145258486 ACAATTGGGAAGGACAAAGAAGG + Intergenic
1033907312 7:146221211-146221233 ATTATTGGGAAGGACACAAAGGG - Intronic
1035413317 7:158663532-158663554 CCTGCTAGGAAGGACACAGTGGG + Intronic
1035940002 8:3888773-3888795 GCTATTTGGAAGGACCCAAATGG - Intronic
1037685900 8:21139207-21139229 TCTATAAAGGAGGAAACAGAGGG - Intergenic
1041033446 8:53761857-53761879 TCTATAAGGAAGGACAAAATGGG + Intronic
1042387804 8:68197625-68197647 TGTATTTGGAAGGACACATTTGG + Intronic
1043452174 8:80378850-80378872 TCTATAGGTAAGGAGACAGAGGG - Intergenic
1045054482 8:98357559-98357581 TTTATTAGTAAGCACACACATGG - Intergenic
1045299294 8:100897307-100897329 TCCAAGAGGTAGGACACAGATGG + Intergenic
1045533738 8:103007767-103007789 TCTGTTAGGAAGCAAAAAGAGGG + Intergenic
1046213577 8:111113260-111113282 GCTATGAGGCAGGTCACAGATGG + Intergenic
1046629697 8:116611224-116611246 TTTATAAGGAAGTGCACAGATGG + Intergenic
1047441797 8:124885232-124885254 TTTATAAGGAAGTGCACAGATGG + Intergenic
1048949468 8:139483405-139483427 TTTATAAGGAAGGGCACAGATGG + Intergenic
1049297460 8:141850313-141850335 TTTACAAGGAAGGGCACAGATGG + Intergenic
1050175361 9:2864507-2864529 TTTGTTAGGAAGGAGCCAGAGGG - Intergenic
1050497195 9:6256002-6256024 CATATTATGAAGGACAAAGAAGG - Exonic
1051062390 9:13059325-13059347 TCTATTAGAAAGGACAGCAATGG - Intergenic
1051968115 9:22854291-22854313 TCTATTAGAATGGGAACAGAGGG - Intergenic
1052018229 9:23494858-23494880 ACTATAGGGAAGGACACAGATGG - Intergenic
1052364077 9:27591654-27591676 ACAATCAGGAAGGACAAAGAAGG + Intergenic
1052726522 9:32234628-32234650 TTTACAAGGAAGTACACAGATGG - Intergenic
1053537183 9:38937612-38937634 TTTATAAGGAAGTGCACAGATGG + Intergenic
1054628952 9:67426318-67426340 TTTATAAGGAAGTGCACAGATGG - Intergenic
1056168353 9:83959494-83959516 TCTATTGGGAAGGAAAAAGCAGG - Intergenic
1056604040 9:88070602-88070624 TCAATTAGAAATGAAACAGAAGG + Intergenic
1057408237 9:94793063-94793085 CCTATTAGAAAGGAAAGAGAGGG + Intronic
1057674162 9:97124005-97124027 AATATTAGGCATGACACAGAAGG + Intergenic
1203374938 Un_KI270442v1:362215-362237 TCTATTAAAAACTACACAGAAGG + Intergenic
1185986821 X:4844514-4844536 TTTATAAGGAAGTGCACAGAAGG - Intergenic
1188206130 X:27360628-27360650 TATTTTAGGAAGGTCACAGCTGG + Intergenic
1189102221 X:38202661-38202683 AATATTAGGAATGAAACAGAGGG + Intronic
1189918321 X:45878649-45878671 GCAATTAGGAAGGATACAGCTGG + Intergenic
1190530633 X:51371417-51371439 ACTATTAGAAAAGACAAAGAAGG + Intergenic
1192658190 X:73014450-73014472 TTTGTGAGGAAGGACACTGAGGG + Intergenic
1193403908 X:81079430-81079452 GCTATTAGGAAGCCCACATATGG - Intergenic
1193405217 X:81092461-81092483 TCAATTAGAAATGAAACAGAAGG + Intergenic
1196995435 X:121377726-121377748 TCTATGAGGAAGGACAGGCAGGG - Intergenic
1199179721 X:144839202-144839224 TCTGTTAGGAAGGAAGAAGAGGG + Intergenic
1201211163 Y:11681905-11681927 TCTAATAGAATGGACACGGAAGG + Intergenic