ID: 1080272576

View in Genome Browser
Species Human (GRCh38)
Location 11:30466556-30466578
Sequence CCTTTGATGCAGAGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080272569_1080272576 2 Left 1080272569 11:30466531-30466553 CCCTAGATGGCAGAGGTCAATCT 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 201
1080272566_1080272576 20 Left 1080272566 11:30466513-30466535 CCTTCAGGGATCGCTGGACCCTA 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 201
1080272570_1080272576 1 Left 1080272570 11:30466532-30466554 CCTAGATGGCAGAGGTCAATCTG 0: 1
1: 0
2: 1
3: 15
4: 221
Right 1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 201
1080272565_1080272576 21 Left 1080272565 11:30466512-30466534 CCCTTCAGGGATCGCTGGACCCT 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080272576 Original CRISPR CCTTTGATGCAGAGGGGAGC AGG Intronic
900396626 1:2455690-2455712 CCTTTGCTGCAGATGGAGGCGGG + Intronic
900610898 1:3544262-3544284 GCTGTGATGCTGAGGGGAGAGGG - Intronic
900618733 1:3577313-3577335 GCTTTGGAGGAGAGGGGAGCAGG - Intronic
901234721 1:7661670-7661692 CCGTGGGTGCAGAGGGGACCTGG - Intronic
902225685 1:14995099-14995121 CCCTGGAGGAAGAGGGGAGCTGG + Intronic
902944562 1:19825484-19825506 CCTCTGCTGGAGAGGGCAGCAGG - Intergenic
903177142 1:21587926-21587948 CCTTTGCTGGAGATGGAAGCTGG - Intergenic
904303970 1:29575161-29575183 CCTGTCAGGCAGAGGGGAGTGGG + Intergenic
905241462 1:36584198-36584220 CCTTTGGTGGGGAGAGGAGCAGG - Intergenic
906105903 1:43292308-43292330 TGTCTGATGCAGAAGGGAGCAGG - Intergenic
906860280 1:49352040-49352062 CATTTGATGCAGAGGTATGCAGG - Intronic
907520520 1:55020555-55020577 CCATGGCTGCAGAGTGGAGCTGG + Intergenic
908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG + Intronic
909554178 1:76934338-76934360 GCTGTGTTTCAGAGGGGAGCTGG + Intronic
909731709 1:78900019-78900041 CCTTTGAGGCAGAGGAGATTTGG + Intronic
912452197 1:109774064-109774086 CATGTGCTGCAGAGAGGAGCTGG + Intronic
915868271 1:159528905-159528927 CCTCTGAGGCAGGGGTGAGCAGG + Intergenic
916926770 1:169529681-169529703 CCTTTGATGAAAAGAAGAGCTGG - Exonic
917428267 1:174938105-174938127 CCTTGGATGTAGAGGGGAAATGG + Intronic
918070229 1:181128968-181128990 AGTTTGAGACAGAGGGGAGCAGG + Intergenic
918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG + Intronic
922512305 1:226179404-226179426 TCCTTGGTGCAGAGGAGAGCAGG + Intronic
922750374 1:228067451-228067473 CCTTGGATGGAGTGGGGAGAGGG - Intergenic
923017780 1:230140168-230140190 CCTCTCAGGCAGAGGTGAGCTGG - Intronic
923147355 1:231207541-231207563 TCTTGGAGGCAGTGGGGAGCTGG - Intronic
1064304572 10:14153695-14153717 CCTGTGATGCAGAGCAGAGCTGG - Intronic
1065491249 10:26283878-26283900 CCGTTGAGGCTGTGGGGAGCTGG + Intronic
1065553018 10:26888011-26888033 CTTTGGATGCAGAGGCCAGCTGG + Intergenic
1065880476 10:30033487-30033509 CCTGTCGTGCAGAGGAGAGCCGG + Intronic
1066581447 10:36886670-36886692 CTTTGGATGCAGAGGCCAGCTGG + Intergenic
1068535856 10:58240947-58240969 CTTTTGATCCAGAGGGGAAAAGG - Intronic
1069620857 10:69836475-69836497 CCTACCATGCAAAGGGGAGCTGG + Intronic
1070327403 10:75397450-75397472 CGTTTTGTGCAGAGTGGAGCAGG - Intergenic
1070661636 10:78310728-78310750 CCTTTGACACAGAGGGTGGCTGG + Intergenic
1071486455 10:86105700-86105722 CCTTTGCTGGAGAGGGGGGATGG - Intronic
1074453374 10:113577318-113577340 CCTTCCATGCAGAAGGGTGCAGG - Intronic
1076314679 10:129532120-129532142 CCTTTGCTGGTCAGGGGAGCTGG + Intronic
1077392919 11:2308264-2308286 CCTCTCAGGCAGTGGGGAGCGGG + Intronic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1078021154 11:7656848-7656870 CCTTTGCTTCTGTGGGGAGCGGG + Intronic
1078091229 11:8265971-8265993 CCTTGGAGGCTGAGGTGAGCTGG - Intronic
1078605608 11:12772413-12772435 CCTCTGATGCAGAATGGAGGAGG + Intronic
1079036652 11:17025987-17026009 GCTAGGATACAGAGGGGAGCTGG - Intergenic
1079828900 11:25235969-25235991 CCTTTGATGCTGAGGCGTACTGG - Intergenic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1080793086 11:35538624-35538646 CATGTGATGCTGAGGGGAGAGGG - Intergenic
1081229047 11:40562384-40562406 AATTTGATGCAGAGGTGAGGAGG + Intronic
1081851251 11:46276702-46276724 CCTTTCACACAGAGGGAAGCTGG + Intergenic
1083146749 11:60765745-60765767 CCATTGGTGCAGAGGGGGACTGG + Intronic
1084601328 11:70147528-70147550 CCCATGATGCAGAGCTGAGCAGG - Intronic
1085389749 11:76176359-76176381 GCTTGGGTGCAGAGAGGAGCAGG + Intergenic
1085400372 11:76232425-76232447 GCTGTGATGCAGAGAGGAGAGGG - Intergenic
1088245056 11:107809829-107809851 CCTTTGACAATGAGGGGAGCAGG + Intronic
1089495179 11:118904520-118904542 CCCTTGGTGCTGAGGGCAGCTGG - Intronic
1089564359 11:119363285-119363307 CCATTTATGCAGCGGGCAGCGGG - Intronic
1090093928 11:123725411-123725433 CCTTTGATGCTGAGGAGAAATGG - Exonic
1090656001 11:128846049-128846071 CCTTTTGTGCACAGGGGATCAGG + Intronic
1090912013 11:131129403-131129425 GCTTTGCTGCTGGGGGGAGCAGG + Intergenic
1091394125 12:143191-143213 CCTGTGCTGAGGAGGGGAGCTGG + Intronic
1092549395 12:9481631-9481653 CCTGTCATGCAGTGGGGAGAGGG + Intergenic
1092585749 12:9899479-9899501 CCATTGAGAAAGAGGGGAGCAGG + Intronic
1096649919 12:53057382-53057404 GCTTTGAGGCAGAGGGGAGCAGG + Intronic
1098150044 12:67537446-67537468 CATTTGATGCAAGGGGGAGAAGG - Intergenic
1102262499 12:111452971-111452993 ACTTTGGTGCAGATGGGAGGGGG - Intronic
1103367594 12:120394540-120394562 CCTTGGCTGCAGCTGGGAGCAGG - Intergenic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1104486173 12:129152778-129152800 CCTGGGATTCAGAGCGGAGCAGG - Intronic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106433668 13:29705620-29705642 GATTTGATGCACAGGGGAGAAGG + Intergenic
1106487846 13:30188309-30188331 CCAGTGATGCATATGGGAGCCGG + Intergenic
1109335709 13:60991050-60991072 CCTTTGGTCCACAGGGGAGAAGG - Intergenic
1109865301 13:68256895-68256917 CCTTTGCAGTAGAGAGGAGCCGG + Intergenic
1114374781 14:22132621-22132643 CCTTGTATGGAGACGGGAGCAGG - Intergenic
1118759589 14:68871898-68871920 CCATTCATGGAGAGGGGAGAAGG - Intergenic
1118883623 14:69849317-69849339 CCTTTGATTTATAGTGGAGCAGG + Intergenic
1125388982 15:39171807-39171829 GCTTTGATGGAAAGGGGAGGGGG - Intergenic
1125461277 15:39909058-39909080 CCTTTGTAGCAGAAGGTAGCAGG - Intronic
1126539649 15:49807909-49807931 CCTTTGATGGACAGGGAAGGGGG - Intergenic
1127707732 15:61563715-61563737 CCTTTGCTGCAAAGGAGACCGGG + Intergenic
1132000855 15:98179021-98179043 CCTTTGATGCAGGGGTAACCAGG - Intergenic
1132502554 16:290999-291021 CCTTTGATGGAGACAGGAGAAGG + Intronic
1132876871 16:2143896-2143918 CATTTCATGGAGAGGGGAGCAGG + Intronic
1132942878 16:2516976-2516998 CCTTTTCTACAGAGGGCAGCAGG - Intronic
1133138529 16:3728795-3728817 CTGTTGCTGCTGAGGGGAGCTGG + Exonic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1138237376 16:55396135-55396157 CCATTGATGCAGAATTGAGCCGG + Intronic
1138840147 16:60491757-60491779 TCTCTGATGCAGAAGGGAGAAGG + Intergenic
1139532399 16:67548842-67548864 CCTGTGAGGCAGAGGGGGTCAGG - Intergenic
1140553244 16:75890912-75890934 CCTGTCAGGCAGAGGGGTGCAGG - Intergenic
1141998413 16:87649118-87649140 CCTCTGCTGCAGAGAGGGGCGGG + Intronic
1142561115 17:809517-809539 CCTGGGAGGCAGAGAGGAGCGGG + Intronic
1143302577 17:5921954-5921976 CATTTGAGGCAGAGGGCTGCTGG + Intronic
1143682138 17:8483839-8483861 CCTTTCCTGCACAGGGGAACAGG + Intronic
1143848846 17:9794330-9794352 TCTCTGATGCAGAGATGAGCAGG - Intronic
1144141400 17:12352313-12352335 TCTGTGATGCGGAGGGGAGCAGG - Intergenic
1144448448 17:15354009-15354031 CCTTTGTAGCAGATGGGAGATGG - Intergenic
1147164495 17:38586209-38586231 CCCTTGGTGGGGAGGGGAGCTGG - Intronic
1148086856 17:44998745-44998767 CCAGTAAGGCAGAGGGGAGCTGG + Intergenic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1150001771 17:61444814-61444836 CGTTTGAGGAAGAGGGCAGCAGG + Intergenic
1152760762 17:82105959-82105981 CCTTTGGAGCAGAGGAGAGGTGG + Intronic
1160425672 18:78777587-78777609 CATTTGCTGCAGAGAGGAACTGG + Intergenic
1161627728 19:5336972-5336994 CCCTGGATGCAGAGGAGAGCTGG + Intronic
1162316190 19:9939593-9939615 GCCCTGATACAGAGGGGAGCAGG - Intergenic
1167250353 19:48395830-48395852 CCTTGGGGGAAGAGGGGAGCTGG + Intronic
926041429 2:9676305-9676327 CCATTGAGGCAGAGGGCAGGTGG - Intergenic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
932429166 2:71663649-71663671 CCTTTGATGCACATGGTAGATGG + Intronic
934571398 2:95375171-95375193 CCTTTGATGCGGACGGGAACGGG + Exonic
935024177 2:99260563-99260585 CCTGTGATGGAGAGAAGAGCTGG + Intronic
935061080 2:99608314-99608336 TCATTGATGCCTAGGGGAGCTGG - Intronic
935094959 2:99935415-99935437 CTTTTAAGGGAGAGGGGAGCAGG + Intronic
936344507 2:111665123-111665145 GCTGTGAGGCAGAGGGGAGTGGG - Intergenic
938379152 2:130826981-130827003 CCTTGGGTGCAGAAAGGAGCTGG - Intergenic
938585918 2:132690659-132690681 CCTATGGTGCAGAGTGGAGCAGG - Intronic
938653247 2:133405761-133405783 CCTCTGAGGCAGAAGTGAGCTGG - Intronic
939982896 2:148802117-148802139 CATATGATGCAGAGAGGAGACGG - Intergenic
941865176 2:170326892-170326914 CCTTTGAAGCAGATTGGTGCTGG + Intronic
943575745 2:189629120-189629142 GCTTTGATGCTGAGGATAGCCGG + Intergenic
944681025 2:202076852-202076874 CCTGTGATGCAGAGCAGAGCAGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948856857 2:240734272-240734294 CCTTGCAGGGAGAGGGGAGCGGG + Intronic
1168903589 20:1386629-1386651 CCTGTCATGCAGTGGGGAGTGGG + Intronic
1169933952 20:10863208-10863230 CCTATGAGGCTGAAGGGAGCTGG - Intergenic
1171366809 20:24630607-24630629 CCTTTGACACAGAGGGGCTCAGG - Intronic
1172240068 20:33407257-33407279 CCTTTCCTGCAGAAGGGAGGTGG - Intergenic
1172707547 20:36893426-36893448 CTTTTATTGCAGAGGGGACCAGG - Exonic
1173222759 20:41142966-41142988 CCTTTGATTCAGAGGCAAGGAGG + Intronic
1173353291 20:42264297-42264319 CTTTTGATTCAGTGGGGAGACGG + Intronic
1173648255 20:44647103-44647125 TCTCTGATGCAGAGGGGAATTGG - Intronic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1175100189 20:56573916-56573938 CCTCTGAAGCAGAGGGAGGCAGG - Intergenic
1176612493 21:8996502-8996524 CCTGTGATGGAGCAGGGAGCAGG + Intergenic
1176712630 21:10166970-10166992 CCTGTGATGGAGCAGGGAGCAGG - Intergenic
1179110539 21:38441814-38441836 CCTTTGAGGAAAAGGGCAGCTGG - Intronic
1179627339 21:42656151-42656173 CCTTTGATGGAGAGGAGATGGGG - Intronic
1179945199 21:44669493-44669515 CCCTTGATGCTGAGGGGTGGAGG - Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1181307892 22:21927361-21927383 CCTCTGAGGCACAGGGGAGGAGG - Intronic
1182849367 22:33458805-33458827 ACTTGAATGCAGAGGTGAGCAGG + Intronic
1184427601 22:44422243-44422265 CCTTGGAAGCAGTGGGCAGCAGG - Intergenic
1184810082 22:46825329-46825351 CCTGTGCTGGTGAGGGGAGCTGG - Intronic
951590729 3:24261571-24261593 CCTTTGCTCTAAAGGGGAGCAGG - Intronic
952861517 3:37816654-37816676 CTTTTCTTGCAGAGGGGAGAAGG + Intronic
953867325 3:46595569-46595591 CCTGGGCTGCAGAGTGGAGCGGG + Intronic
960367974 3:116796683-116796705 CCTGTGATACAGAGCTGAGCAGG + Intronic
960418766 3:117417192-117417214 CATTTAATACAGAGGGGAACAGG + Intergenic
960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG + Intronic
962443978 3:135448794-135448816 CCTTTGATAAAGGGGGGATCTGG + Intergenic
968270493 3:197399632-197399654 CCAGGGATGCAGAGGAGAGCTGG + Intergenic
969269497 4:6089589-6089611 CCTTTGGGGCAGAGGGGACAGGG - Intronic
978333782 4:107644413-107644435 TCTTTGTTAAAGAGGGGAGCTGG - Intronic
978437581 4:108702153-108702175 CCACTGATGTAGAGGGGAGTTGG - Intergenic
981112109 4:140947424-140947446 CCTTTGATGCAAAGGGGATAGGG + Intronic
982762982 4:159309597-159309619 CCTTAGAAGCAGATGGGGGCAGG + Intronic
983029732 4:162784913-162784935 GCTTTAATGCAGAGGTGAACTGG + Intergenic
985818108 5:2141743-2141765 CCTCTGAGGCAGATGGGAGCTGG - Intergenic
987259436 5:16188557-16188579 TCTTGGGTGAAGAGGGGAGCAGG + Intergenic
987374045 5:17217905-17217927 CCCTTCATGCAGCGGGCAGCAGG + Intronic
988225472 5:28406704-28406726 CCTTTTCTGAACAGGGGAGCGGG + Intergenic
988438919 5:31209797-31209819 ACTTTGATGCTGAGGATAGCAGG - Intronic
989777711 5:45229215-45229237 ACTTTGAGGAAGATGGGAGCAGG - Intergenic
992038537 5:72805748-72805770 CCAGGGATGCAGAGAGGAGCTGG - Intergenic
995281687 5:110342799-110342821 GCTAGGCTGCAGAGGGGAGCTGG - Intronic
995686625 5:114779544-114779566 CCTTAGATGAAGAGGGGATATGG - Intergenic
999222024 5:149988232-149988254 CCTTTGGTGAAGAGGGGAGGAGG + Intronic
1001586286 5:172835253-172835275 GCTTTAATGCAGGGAGGAGCTGG + Intronic
1002661755 5:180796091-180796113 CCTGTGAGGCAGAGGGCAACTGG - Intronic
1003845200 6:10166686-10166708 CCCTTGATGAATATGGGAGCAGG - Intronic
1005018027 6:21392317-21392339 CATTTGAAGCAGAGGGGTGTGGG - Intergenic
1006100759 6:31684729-31684751 CCTTAAATGCAAAGAGGAGCTGG - Intergenic
1006341214 6:33448170-33448192 CCTGAGATGCAGAGAGGAGTGGG - Intronic
1008786733 6:55176798-55176820 GCGTTGATGCAGAGGAGAACAGG - Intronic
1010266600 6:73874936-73874958 CCATTGATGCACAAAGGAGCTGG - Intergenic
1012111225 6:95237539-95237561 CCTCTTATACAGAGTGGAGCAGG - Intergenic
1012477932 6:99635510-99635532 GCTTTGATACAGAGGGGTGTAGG + Intergenic
1013188495 6:107782557-107782579 GCTTTGGTGCAGAGAAGAGCAGG - Intronic
1013352577 6:109318799-109318821 CCTTCAATGCAGTGGGGGGCAGG + Intergenic
1016535228 6:145102753-145102775 TCCTTGATGAAGAGGGGAGTGGG - Intergenic
1017266971 6:152458426-152458448 CCATTGATAGAAAGGGGAGCTGG + Intronic
1021312068 7:19108152-19108174 CCTTTTAGGCAGCGGGGACCAGG - Intronic
1022924921 7:35047065-35047087 CCTGTCATGCTGAGGGGAGGAGG + Intergenic
1023049076 7:36235515-36235537 ACAGAGATGCAGAGGGGAGCCGG - Intronic
1024948868 7:54838025-54838047 CTTTTGCTGCAGAGCGGAACGGG - Intergenic
1026803149 7:73412420-73412442 TCTTTGATGAAGATGGCAGCAGG - Intergenic
1028115423 7:86991751-86991773 CCTTGGATGCTGAGGTGACCTGG - Intronic
1029822932 7:103161770-103161792 CCTGTCATGCTGAGGGGAGGAGG + Intergenic
1031693892 7:124825088-124825110 CCTTTGATGAAGAGAGTGGCAGG - Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1035640240 8:1179254-1179276 CCTTAGATGCAGAGTGGGGGTGG + Intergenic
1036119139 8:5996453-5996475 CCTCTGATGCAGCAGAGAGCAGG + Intergenic
1037802683 8:22043988-22044010 CCTTTGAAGCAGTGGGGGGGTGG + Intronic
1038424948 8:27458915-27458937 CCCTTGATGCACAGAGAAGCTGG + Exonic
1039076388 8:33693829-33693851 CTCTTAATGGAGAGGGGAGCTGG - Intergenic
1039247818 8:35629003-35629025 TCTTTGATGCAGAGGAGGGGAGG + Intronic
1039252929 8:35686536-35686558 CCTTTGAAGTGGATGGGAGCTGG + Exonic
1045384539 8:101658630-101658652 CCTTTCATGCTTTGGGGAGCTGG + Intronic
1045411901 8:101928560-101928582 CATTTGATTTAGAGGCGAGCAGG - Intronic
1047278688 8:123426022-123426044 TCTTTTTTGCAGGGGGGAGCGGG - Intronic
1050287284 9:4117085-4117107 CCTTTGGTGCTGAGGGAAGTGGG - Intronic
1052769491 9:32674399-32674421 CCTTTGATGGAGAGTGTTGCTGG - Intergenic
1053649635 9:40152771-40152793 CCTGTGATGGAGCAGGGAGCAGG - Intergenic
1053756116 9:41311176-41311198 CCTGTGATGGAGCAGGGAGCAGG + Intergenic
1054330149 9:63744534-63744556 CCTGTGATGGAGCAGGGAGCAGG - Intergenic
1054534946 9:66223433-66223455 CCTGTGATGGAGCAGGGAGCAGG + Intergenic
1057176597 9:93004748-93004770 CTCCTGATGCAGAGGGAAGCCGG - Intronic
1058629739 9:106974295-106974317 TCTTGGATGCAGCGGGGGGCAGG + Intronic
1062521984 9:136961743-136961765 CCTGTGGTGCAGAGCTGAGCTGG + Intergenic
1202797377 9_KI270719v1_random:135960-135982 CCTGTGATGGAGCAGGGAGCAGG - Intergenic
1186165501 X:6822379-6822401 GGTTTGATGAAGAGGGGGGCAGG - Intergenic
1189289757 X:39876822-39876844 CTGTTGATGCAGAGAGAAGCAGG + Intergenic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1194039715 X:88925154-88925176 CCTTTGATGTGGAGAAGAGCAGG + Intergenic
1194602244 X:95936400-95936422 CCTTTGTTGCAGAAGTGAGATGG + Intergenic
1195298521 X:103503789-103503811 CCTTTAATGCAGACAGGGGCTGG - Intronic
1196123942 X:112080325-112080347 CTTTTGTAACAGAGGGGAGCAGG - Intronic
1197116429 X:122838920-122838942 CATTTGATGCTGAGGGGACATGG + Intergenic