ID: 1080276479

View in Genome Browser
Species Human (GRCh38)
Location 11:30508731-30508753
Sequence ACGTTTGGCCCTTTGTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080276479 Original CRISPR ACGTTTGGCCCTTTGTCTGT GGG (reversed) Intronic
905793997 1:40805213-40805235 ACGTTTGCCCCATTGTGAGTTGG - Intronic
911393667 1:97277977-97277999 ATATTTAGCCCTTTGTCTTTGGG + Intronic
917204151 1:172552247-172552269 ACGTTTGGACCTTGTTCTGTGGG + Intronic
919145630 1:193630817-193630839 ACTTTTGCCCCTTTTTCTATCGG - Intergenic
923070244 1:230557831-230557853 ACGGTTGGCCCTTGGTATCTCGG - Intergenic
923876042 1:238048573-238048595 ACATCTGGGACTTTGTCTGTTGG + Intergenic
923963814 1:239113521-239113543 AACATTGGCCCTTTGGCTGTAGG - Intergenic
924582299 1:245332942-245332964 ACATTTTGCCCTTTTTCTGCTGG - Intronic
924651918 1:245937287-245937309 ACATTTGGCAGTTTGACTGTGGG - Intronic
1063218697 10:3946458-3946480 CTGTTTGGCCCTTTCTCGGTAGG + Intergenic
1065394271 10:25217408-25217430 ACCTTTGGCCCTAGGTCTTTCGG - Intronic
1067249095 10:44572281-44572303 CGGTTTGGCCCTTTTTCTGGTGG + Intergenic
1067933872 10:50591380-50591402 TTGTTTGGCCATTTGGCTGTGGG - Intronic
1070911999 10:80127057-80127079 TCCTTTGGCCCTTTGCCTTTGGG + Intergenic
1071685901 10:87756136-87756158 ACTCTTGTCCCTTTGTCTCTTGG - Intronic
1073360278 10:102893223-102893245 ACCTTTGGCTTTTTGTTTGTTGG + Intronic
1074687034 10:115971038-115971060 AAGGTTGCCGCTTTGTCTGTTGG + Intergenic
1077732306 11:4745227-4745249 TCGTTTTGATCTTTGTCTGTGGG - Intronic
1078565775 11:12412690-12412712 TCTTTTGTCCCTTTCTCTGTAGG - Intronic
1080276479 11:30508731-30508753 ACGTTTGGCCCTTTGTCTGTGGG - Intronic
1080931776 11:36818751-36818773 ATGTTTTACCCTGTGTCTGTTGG + Intergenic
1082170751 11:49002132-49002154 ACATTTGGACATTTGTATGTGGG + Intergenic
1085509554 11:77081384-77081406 TCATTTGGCCTTATGTCTGTTGG + Intronic
1085629706 11:78104439-78104461 ATTTTTAGCCTTTTGTCTGTGGG - Exonic
1086630833 11:89017838-89017860 ACTTATGACCCTTTCTCTGTAGG - Intronic
1086695054 11:89834228-89834250 ACATTTGGACATTTGTATGTGGG - Intergenic
1086711096 11:90010256-90010278 ACATTTGGACATTTGTATGTGGG + Intergenic
1087736640 11:101841532-101841554 ACATTTGGCCCTTGGACTTTTGG - Intronic
1089251840 11:117169123-117169145 AATTTTGGGCCTTTTTCTGTGGG + Exonic
1091989701 12:4945320-4945342 ACATGTGGCCCTTTGTCTCAAGG + Intergenic
1092305367 12:7295284-7295306 ACCTTTGGCTTTTTGTTTGTTGG + Intergenic
1099938516 12:89157291-89157313 CCTTTTTGCCCTTTTTCTGTTGG + Intergenic
1103428566 12:120861167-120861189 ACAGTTGGCCCTGTCTCTGTGGG - Intronic
1105385743 13:19927959-19927981 ATTTTTGCCCCTTTGTCAGTTGG + Intergenic
1107809775 13:44189170-44189192 ATGTTTGGACTTTTTTCTGTAGG - Intergenic
1112408139 13:99138786-99138808 ACTTTTGGCTTTTTGTTTGTTGG - Intergenic
1116157996 14:41233004-41233026 ACAGTCAGCCCTTTGTCTGTGGG + Intergenic
1117844908 14:59900775-59900797 TGGTTTGGCCCTTTTTCTGGTGG - Intergenic
1121997787 14:98617318-98617340 ACGTTTGGCCTTTTATTTGGGGG - Intergenic
1125726076 15:41868739-41868761 ACATGTGGCCCTTTGTCACTTGG + Intronic
1133770019 16:8862455-8862477 AAGTTCAGCCCTTTGTCTCTGGG - Intronic
1134875821 16:17697723-17697745 CCCTTTGGCCCTCTGTCTGAAGG - Intergenic
1142198138 16:88748225-88748247 ACGTTTGGCCCATGGCCTTTGGG + Intronic
1150170805 17:62991941-62991963 AGGTTTGACCCTTTGTGTGTGGG + Intergenic
1151865661 17:76800490-76800512 TGGTGTGGCCATTTGTCTGTGGG + Intergenic
1153808895 18:8734592-8734614 ATGTTTGGGCCCTTCTCTGTGGG + Intronic
1157904473 18:51557067-51557089 ATTTCTGGCCCTTTCTCTGTTGG + Intergenic
1162494770 19:11017574-11017596 CCGTTTGGACCTCTGTCTCTGGG + Intronic
1164974397 19:32560974-32560996 TGGTTTGGCCCTTTTTCTGGTGG + Intergenic
1166467594 19:43046519-43046541 ACGTTTTTGCCTATGTCTGTTGG + Intronic
1166474213 19:43107308-43107330 ACGTTTTTGCCTATGTCTGTTGG + Intronic
1166488181 19:43232385-43232407 ACGTTTTTGCCTATGTCTGTTGG + Intronic
1166861247 19:45812684-45812706 ACGTAAGGCCTTTTGTTTGTTGG + Intronic
1167348802 19:48962726-48962748 ACCTTTGGCCCTCTTTCTCTGGG + Intergenic
927112523 2:19874135-19874157 AGCTTTGTCCCTTTGTATGTTGG - Intergenic
930723243 2:54658055-54658077 CCGCTGGGCCCTTTGTCTGTTGG + Intronic
931247992 2:60507139-60507161 ATCCTTGGCCCTCTGTCTGTTGG - Intronic
935143539 2:100377379-100377401 AAGTTTGGCCTTTGGTCAGTGGG + Intergenic
941099988 2:161284817-161284839 ACGGTTGGCCCTTGCTCAGTGGG - Intergenic
944189663 2:196989084-196989106 AGGTTTGGCCCTTGGGCTTTTGG + Intronic
946073524 2:217054511-217054533 AGGTTTGGTCCCTAGTCTGTGGG + Intergenic
948180954 2:235979678-235979700 AAAATTGGCCATTTGTCTGTGGG + Intronic
949010926 2:241677929-241677951 ACATTTGGCGCTTTGTCTGGTGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1174887002 20:54346858-54346880 ACGTTTTGCTATTTTTCTGTGGG - Intergenic
1177888226 21:26772065-26772087 ACGTTTGTCACTTTGTCTCTGGG - Intergenic
1179634269 21:42697220-42697242 ACTTTGGGCCCTTTGTCTGTAGG - Intronic
1182135500 22:27898831-27898853 ACTTTTGCCCCTTTATATGTTGG - Intronic
949617672 3:5772300-5772322 ACGTTTGGCCCTCTATCTGCAGG + Intergenic
955446201 3:59013057-59013079 TCCTTTAGCCCTTTGTCTTTTGG - Intronic
961666220 3:128494503-128494525 CCCTTTGGCTCTGTGTCTGTGGG + Intergenic
964656713 3:159074990-159075012 ACCTTTGTCCCTTTGTTAGTTGG - Intronic
967169571 3:186812574-186812596 AGGTTTAGCCCTTTGTCTTAAGG + Intergenic
967194738 3:187016600-187016622 ACGTTTGGACATTTTTCTTTGGG - Intronic
969189434 4:5505161-5505183 ACTCAGGGCCCTTTGTCTGTTGG - Intergenic
971573210 4:28240320-28240342 ACCTTTGCTCATTTGTCTGTTGG - Intergenic
972434840 4:39023431-39023453 ACATTTGTCCCTTTATCTATTGG - Intronic
976941740 4:90710188-90710210 ACCTTTGTCCCTTTGTCAGATGG + Intronic
981736732 4:147961362-147961384 TCTTTTGCCCTTTTGTCTGTTGG + Intronic
985437473 4:189944755-189944777 ACGTTTGTCTGTTTTTCTGTTGG + Intronic
990025111 5:51178658-51178680 ACATTCTGCCCTTTGTCTGAAGG + Intergenic
990613840 5:57487054-57487076 ACGTTAGGCCCTTTATCCATCGG - Intergenic
993061576 5:83044729-83044751 ATTTTTGCCCATTTGTCTGTGGG - Intergenic
994355170 5:98786500-98786522 ATGTTTGGTCCTTTTTTTGTTGG + Intronic
1004517129 6:16329866-16329888 ATATTTGGCCTCTTGTCTGTTGG - Intronic
1004799105 6:19126139-19126161 ATCTTTGGCCCATTGTCTTTTGG - Intergenic
1005433175 6:25779964-25779986 TCGTTTGCCCCTCTGACTGTTGG + Exonic
1009989452 6:70823820-70823842 ACGGTTGGCTCTCTATCTGTGGG - Intronic
1010198181 6:73260880-73260902 ACATTTGCCCATTTCTCTGTAGG + Intronic
1011142273 6:84171953-84171975 ACCTTAGGCCCTTTGGCTTTGGG - Intronic
1018971156 6:168530438-168530460 ACTTTTGGCCGTTTTTCTGCTGG - Intronic
1019127892 6:169853302-169853324 ACGTGTGTCCATTTGTGTGTAGG + Intergenic
1027738895 7:81974754-81974776 ACGTTTGGCCTTTGGACAGTAGG + Intronic
1030876705 7:114821983-114822005 AAGTTTCTCCCTTGGTCTGTGGG + Intergenic
1031030889 7:116733876-116733898 TCGAATAGCCCTTTGTCTGTAGG - Intronic
1031850630 7:126858528-126858550 TCTTTTAGCCCTTTATCTGTTGG - Intronic
1032427752 7:131835101-131835123 ACTTTTGGCTCTTGGTCTTTAGG + Intergenic
1040757928 8:50803344-50803366 ACATTTGGACATTTGTCTATTGG - Intergenic
1040801057 8:51340974-51340996 ACGTGTGGTCTTTTGACTGTTGG - Intronic
1042257665 8:66822165-66822187 ATGTTTGCCCATTTGTCTATTGG + Intronic
1043543526 8:81289722-81289744 ACAATTGGGCCTTTGTCTGATGG + Intergenic
1046771112 8:118117472-118117494 CCGTTTTTCCCTTTTTCTGTTGG - Intergenic
1051453212 9:17221594-17221616 AAGTTTAGCCCTTTGGATGTAGG - Intronic
1057732298 9:97620975-97620997 ACATTTTCCCCTTTGTCTTTGGG - Intronic
1058673161 9:107378242-107378264 ACGTGTGGCCCTTTATAAGTAGG + Intergenic
1061286854 9:129628519-129628541 ATGGTTGGACTTTTGTCTGTAGG + Intronic
1061491185 9:130945163-130945185 AAGTTTGTCCTCTTGTCTGTTGG - Intergenic
1185747737 X:2585251-2585273 ACGTTTGTCCCTTACTCTCTGGG + Intergenic
1186180584 X:6969080-6969102 AGGCTTGGCCCCCTGTCTGTGGG - Intergenic
1190677789 X:52797016-52797038 TGGTTTGGCCCTTTTTCTGGTGG - Intronic
1190811288 X:53886984-53887006 ACATTTGGCCCCATATCTGTGGG + Intergenic
1191004120 X:55692130-55692152 AAGGTTGGCCCTTTGTCAGATGG - Intergenic
1191829341 X:65399168-65399190 ACATTTGTCCATTTGTGTGTTGG - Intronic
1193802312 X:85951621-85951643 ACTTTTGCCCATTTGTCTATTGG - Intronic
1193942923 X:87698460-87698482 ACATTTGGCCTGCTGTCTGTGGG + Intergenic
1193978832 X:88157040-88157062 AATTTTAGCCCTTTGTCTGCAGG - Intergenic
1194398847 X:93418986-93419008 ACTACTGCCCCTTTGTCTGTGGG - Intergenic
1195565748 X:106337068-106337090 ACCTTTGGCTTTTTGTTTGTTGG - Intergenic
1198854620 X:141003019-141003041 TGGTTTGGCCCTTTTTCTGGTGG + Intronic
1198877398 X:141242128-141242150 TGGTTTGGCCCTTTTTCTGGTGG - Intronic
1198908081 X:141584349-141584371 TGGTTTGGCCCTTTTTCTGGTGG - Intronic
1198908710 X:141590075-141590097 TGGTTTGGCCCTTTTTCTGGTGG + Intronic
1198918360 X:141698076-141698098 TGGTTTGGCCCTTTTTCTGGTGG - Intronic
1199012904 X:142778159-142778181 ACATTTGGCCCTTGGTTTATGGG + Intergenic
1199033338 X:143026328-143026350 CAGTTTGGCCCTTTTTCTGGTGG + Intronic
1199043976 X:143147345-143147367 ACATTTTCCCCTTTGTCTTTTGG - Intergenic
1199215374 X:145255261-145255283 TGGTTTGGCCCTTTTTCTGGTGG + Intronic
1199969789 X:152851370-152851392 TCCTTTGCCCCTTTGTCTTTGGG + Intronic