ID: 1080279540

View in Genome Browser
Species Human (GRCh38)
Location 11:30540743-30540765
Sequence GTGCAGAACTAGGATTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080279540_1080279542 21 Left 1080279540 11:30540743-30540765 CCTTCTTAATCCTAGTTCTGCAC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1080279542 11:30540787-30540809 GAACCCAGTCCCTTTTCCATTGG 0: 1
1: 0
2: 1
3: 16
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080279540 Original CRISPR GTGCAGAACTAGGATTAAGA AGG (reversed) Intronic
909185965 1:72486298-72486320 GTACTGAACTAGGTTTAAAAAGG - Intergenic
910763482 1:90758068-90758090 GTGAAAAACTAGTATGAAGATGG + Intergenic
911930709 1:103899942-103899964 GGGCAGAACTATGATGCAGAGGG + Intergenic
913232727 1:116755202-116755224 GTGAAGAACCTGGATTAAGGTGG + Intronic
918159406 1:181883376-181883398 CTGCAGAAGTAGGTTTCAGAAGG + Intergenic
920161383 1:204000778-204000800 GTGAAGAACTTGGTTAAAGAGGG + Intergenic
920869399 1:209781506-209781528 GTGCAAAACTTGGTTAAAGAAGG - Exonic
921258600 1:213365159-213365181 ATGCAGAACCAGTATTAAGACGG + Intergenic
923578586 1:235185419-235185441 GTGCAGAGATAGGATGAATAAGG - Intronic
924898374 1:248368022-248368044 ATGCAGAACTCGGATAAAGAGGG - Intergenic
1064001894 10:11670630-11670652 CTGGAGAACTAGGATGAAGTGGG - Intergenic
1067144892 10:43687832-43687854 GGGCAGAAGTAGGAAGAAGAGGG + Intergenic
1069575298 10:69523235-69523257 GAGCAGAAAAAGGATTAAAAGGG - Intergenic
1073047548 10:100649577-100649599 ATGCAGGACTAGGAATGAGAGGG + Intergenic
1074510727 10:114109612-114109634 GTGCATAACTTGGAACAAGATGG - Intergenic
1074632674 10:115275405-115275427 GTGCATAGCTAGGATTTAGTAGG + Intronic
1074727865 10:116332335-116332357 GTGCAGAATTATGGTTAATATGG - Intronic
1075551807 10:123398229-123398251 GAGCAGAACCAGGATCAACAGGG - Intergenic
1076254380 10:129009975-129009997 CTGCAGAACTAGGGACAAGAGGG + Intergenic
1077321012 11:1941992-1942014 GGGGGGAACTGGGATTAAGATGG + Intergenic
1079349813 11:19682967-19682989 TTGCAGAACTAGGATGAGGGAGG + Intronic
1080279540 11:30540743-30540765 GTGCAGAACTAGGATTAAGAAGG - Intronic
1081385945 11:42473358-42473380 GTGTAGAATTAGGATAAGGAGGG + Intergenic
1090199956 11:124846689-124846711 GTGCTGAAATAGGATTTAAATGG + Intergenic
1094653707 12:32400889-32400911 GTTCAGAACCAGGACTAAAAGGG - Intronic
1096481982 12:51948402-51948424 GTCCAGCCCTAAGATTAAGACGG + Intergenic
1098425291 12:70357896-70357918 GAGCAGAACTAGGACAAATAAGG + Intergenic
1099014992 12:77333668-77333690 GTCCAGAACCAGGCTTAAGAAGG - Intergenic
1101549588 12:105749545-105749567 TTGCAGAACTAGAAATGAGAGGG + Intergenic
1104600647 12:130151111-130151133 GAGCAGAACTAGGATTTTGGAGG - Intergenic
1105048230 12:133025048-133025070 GAGCAGAACTAAGATCCAGAGGG + Exonic
1106223101 13:27763408-27763430 TTTCAGAACTAGAATAAAGAGGG + Intergenic
1106385308 13:29279232-29279254 GTGCAGATCTGGGAGCAAGATGG - Intronic
1106573891 13:30956555-30956577 GGCCAGAACTAGAATTAACATGG + Intronic
1106920333 13:34556431-34556453 AAGCAGAAGTGGGATTAAGATGG + Intergenic
1108725851 13:53180389-53180411 GTGCAGAATAAGGACAAAGATGG + Intergenic
1109365263 13:61347057-61347079 GGGCAAAACTGGGATTCAGAAGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113835762 13:113327667-113327689 GTGCAGAACAAGGATATGGAAGG - Intronic
1114461723 14:22890424-22890446 GTGCAGAACTTGGAGTAAAGGGG + Intergenic
1121944199 14:98103488-98103510 GTGCAGTACTTGGTTTAATAAGG + Intergenic
1126044743 15:44628438-44628460 GGGCAGATCTAGCATTAAGAGGG + Intronic
1126380306 15:48039679-48039701 GTGAAACACTAGGATTTAGAAGG + Intergenic
1127680843 15:61296491-61296513 GAAAAAAACTAGGATTAAGAAGG + Intergenic
1129279176 15:74470241-74470263 GTCCAGGACTGGGGTTAAGAGGG + Intergenic
1131565874 15:93484983-93485005 GTGTTGAACTAGGAGTAAGAAGG - Intergenic
1132785133 16:1652690-1652712 GTGCAGCCCTGGGATTAAGCAGG - Intronic
1139752346 16:69116863-69116885 GTGCAGAACCAGCACTAAGGTGG + Exonic
1149095982 17:52841565-52841587 ATGGAGAACTAAGATTAGGATGG + Intergenic
1157655658 18:49385345-49385367 GTTAAGAACTAGGACAAAGAAGG + Intronic
1161951746 19:7471446-7471468 GTGCAGAACAAGGCTTGACATGG - Exonic
1165275220 19:34744992-34745014 ATACAGAACTAGGAAAAAGAAGG + Exonic
1165404519 19:35621635-35621657 GTGCAGCACTTGGATGAGGAGGG - Intronic
1168024025 19:53630711-53630733 GTGCAGAACTGAGATTCAAATGG + Intergenic
931163484 2:59719609-59719631 GTGCAGTGCTTGGATTAAGCTGG - Intergenic
931669604 2:64635612-64635634 GTGAAGCACAAGGATTAAGTTGG - Exonic
932465386 2:71920130-71920152 ATGCAGAACCATGATTAAGAAGG - Intergenic
933885646 2:86717888-86717910 GTGCAGGACTAGGTTCTAGAAGG + Intronic
934676655 2:96254108-96254130 CTGCAGAACTAGGAGACAGAGGG + Exonic
935901407 2:107797587-107797609 GTGAAGAGCTAGAATTAATATGG - Intergenic
939090118 2:137770392-137770414 GTGAAGATCTAGGATTAGGTAGG - Intergenic
939519487 2:143211850-143211872 AAGCTGAACTAGGATTCAGATGG + Intronic
940455647 2:153895566-153895588 ATGCAGAACTAGGGTCAAGTTGG + Intronic
941388404 2:164881540-164881562 GTGAAGAAGTAGGACTGAGAAGG + Intergenic
943082984 2:183278918-183278940 GTGCAGAAGTATGAAAAAGAGGG + Intergenic
947086171 2:226455082-226455104 TTGCAGAAGTAGGCTTCAGACGG + Intergenic
947127790 2:226889844-226889866 GTACAGAGCTAGGAGGAAGAGGG - Intronic
948250445 2:236524299-236524321 GAGCTGAACTAGGATTAACGAGG + Intergenic
948638118 2:239353320-239353342 GGTCAGAACAAGGATAAAGAAGG - Intronic
1169092601 20:2870835-2870857 ATGCAGGACTAGGAGTAGGAGGG + Intronic
1169265241 20:4163372-4163394 ATGCAGAGCTAGGATGAAGTGGG - Intronic
1170276294 20:14594180-14594202 GTGAAGAACCAGGTTGAAGAGGG - Intronic
1174880407 20:54273360-54273382 ATGTAGGACAAGGATTAAGAGGG - Intergenic
1177475306 21:21612777-21612799 GTACTGAACTGTGATTAAGATGG + Intergenic
1180038074 21:45260645-45260667 GTGCAGACCTTAGATTCAGAAGG - Intergenic
1182171657 22:28236138-28236160 CTGCGGAACTAGGATTGTGAAGG - Intronic
1183041433 22:35181737-35181759 GTGCTGAAGTTTGATTAAGAAGG + Intergenic
1184277612 22:43419125-43419147 GTGAAAAACTAAGATTAAGGGGG + Intronic
949095637 3:82085-82107 ATGCAGAACTGTGATGAAGAAGG + Intergenic
949959188 3:9297961-9297983 GTGAAGACCAAGGAATAAGAAGG + Intronic
955915929 3:63908159-63908181 GTGCAAAATTAGGAATAATAAGG - Intronic
960140849 3:114150703-114150725 GTGCACAACAAGGGTTAAGGAGG - Intronic
960660281 3:120050546-120050568 GTGGAGAACTAGGTGTAAGGAGG + Intronic
970174005 4:13319477-13319499 GAGCAAAAATAGTATTAAGAGGG - Intergenic
974286157 4:59870189-59870211 ATGAATATCTAGGATTAAGAGGG - Intergenic
975863829 4:78705338-78705360 ATGCTGAACAAGGATTCAGAGGG - Intergenic
978559802 4:110021262-110021284 TTGCAGAGCTAAGATTATGAAGG - Intergenic
979324049 4:119358291-119358313 TTGAAGAAATAGGTTTAAGAAGG + Intergenic
980963783 4:139501277-139501299 GTGCTGAACTTGGATGAAGCTGG + Intronic
983241885 4:165242977-165242999 TTGAAGAAATAGGCTTAAGAAGG + Intronic
983525840 4:168759709-168759731 GTGCAGGTCCAGGATTATGAGGG + Intronic
983526112 4:168761852-168761874 GTGCAGGTCCAGGATTATGAGGG - Intronic
983972415 4:173890980-173891002 GTGCTGTACTAGGCATAAGATGG + Intergenic
985149642 4:186933479-186933501 GTGCAGAATTAGGACTTAGTAGG - Intergenic
988399270 5:30740949-30740971 GCACAGAAATAAGATTAAGAAGG - Intergenic
989528936 5:42484027-42484049 GTGCAGAACGAGCACTAAGTAGG + Intronic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
998353775 5:141517711-141517733 AAGCAGAACTGGGATAAAGATGG + Intronic
999422254 5:151454993-151455015 GGTCAGAACTAGGATCAAGAGGG - Intronic
1000976981 5:167775432-167775454 ATGCAGAACTAGGTTTAACTGGG + Intronic
1001418023 5:171562133-171562155 GTGAATACCTAGGATTAGGATGG + Intergenic
1001807015 5:174595506-174595528 GTGGAGAATTAGGAGTAAGCAGG - Intergenic
1003425640 6:5996622-5996644 GAGGAGAACCAGGATAAAGAGGG - Intergenic
1005771558 6:29078018-29078040 ATGTGGAACTAGGATTATGATGG - Intergenic
1008697899 6:54062889-54062911 GTGCAGGGCTAGAATTAATATGG + Intronic
1009400803 6:63253513-63253535 GAGCAGAAGTAGGAATCAGATGG + Intergenic
1011230955 6:85161569-85161591 GAGCAGCACTTGGATAAAGAGGG - Intergenic
1012150683 6:95747117-95747139 GTGGGAATCTAGGATTAAGATGG + Intergenic
1012314640 6:97770687-97770709 GGGCATAACTAGGATCAACATGG + Intergenic
1013124974 6:107174138-107174160 GTCCAGTATTAGGATGAAGAAGG + Intronic
1015721948 6:136251492-136251514 GCGCAGAACAAGGATGATGATGG + Intergenic
1015742450 6:136471337-136471359 ATAAAGAACTACGATTAAGAAGG - Intronic
1017093069 6:150779014-150779036 GTGCAGGACTGGGATTCAGAAGG + Intronic
1018312447 6:162525145-162525167 GGGCAGAGCTAGGACTAAGCAGG - Intronic
1023428304 7:40063079-40063101 TTGCACAACTAGAATTAATAAGG + Exonic
1030301840 7:107982087-107982109 CTGCAGACCTAGGAAGAAGAGGG - Intronic
1030346768 7:108442502-108442524 GTCCAGAACAGGGAATAAGATGG + Intronic
1033071569 7:138208087-138208109 GTTCAGAACAAAGATGAAGACGG - Intergenic
1033277543 7:139984043-139984065 GTGATGAAGTAGGATGAAGATGG + Intronic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1036777667 8:11624808-11624830 GTGAATAACTAGGATGCAGAGGG - Intergenic
1037161136 8:15773844-15773866 ATGCAAAACTAGGATAAAGTTGG + Intergenic
1037597043 8:20362971-20362993 GTGCTGAACTAGGCTTATAATGG - Intergenic
1038181620 8:25234340-25234362 GAACAGATCTAAGATTAAGACGG - Intronic
1042990006 8:74628704-74628726 GTTCAGTAGTAGGATAAAGAAGG + Intronic
1043313558 8:78892717-78892739 GTGCAGAAGAAGGGTTAAGCAGG - Intergenic
1044505120 8:93007538-93007560 ATGCAGAAGTAGGCTTCAGAAGG + Intronic
1047682600 8:127269703-127269725 GTGCAGAAGCAGGATTTGGATGG - Intergenic
1050102187 9:2130486-2130508 GAGCAGAATTAGGATAAAGTTGG - Intronic
1050943763 9:11491897-11491919 GTGCATAACTTGAATGAAGAAGG - Intergenic
1050986189 9:12086005-12086027 ATGCATTTCTAGGATTAAGATGG - Intergenic
1051192489 9:14530033-14530055 CTGAAAAACTGGGATTAAGATGG - Intergenic
1051705949 9:19879922-19879944 GTTAAGAACCAGGTTTAAGAGGG - Intergenic
1051780218 9:20681824-20681846 CTGCAGATCTAGGGTTAAGCTGG - Intronic
1051992347 9:23166862-23166884 GTGCAAAATCAGTATTAAGAGGG + Intergenic
1059496958 9:114717938-114717960 GGGCAGAGGTAGGATGAAGATGG - Intergenic
1059573124 9:115461631-115461653 GAACAGAACTAGAATTCAGAGGG - Intergenic
1060826957 9:126693141-126693163 GTGAAGAGCGAGGATGAAGATGG + Exonic
1186929269 X:14370348-14370370 GAACAGAAGTAGGATTCAGAAGG + Intergenic
1187299031 X:18030182-18030204 GATCAGAAGCAGGATTAAGAGGG - Intergenic
1196735463 X:118977495-118977517 GTGCAGTACTTGGAATAATACGG - Intronic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1199495238 X:148445610-148445632 CTGCAGGACTAGGTCTAAGAAGG - Intergenic
1199727510 X:150599209-150599231 GTGTAGAACTAGGATGACTATGG + Intronic
1201744792 Y:17360064-17360086 GAGCAGAATTAGGATTGAGAGGG + Intergenic