ID: 1080281504

View in Genome Browser
Species Human (GRCh38)
Location 11:30562646-30562668
Sequence AGGCACCTACAGCTTATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080281498_1080281504 -3 Left 1080281498 11:30562626-30562648 CCCCAAACTGTAAGTTCCTTAGG 0: 1
1: 0
2: 2
3: 23
4: 181
Right 1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 78
1080281500_1080281504 -4 Left 1080281500 11:30562627-30562649 CCCAAACTGTAAGTTCCTTAGGC 0: 1
1: 0
2: 2
3: 25
4: 196
Right 1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 78
1080281497_1080281504 21 Left 1080281497 11:30562602-30562624 CCTACTCAGTTAGCATTTATTGT 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 78
1080281501_1080281504 -5 Left 1080281501 11:30562628-30562650 CCAAACTGTAAGTTCCTTAGGCA 0: 1
1: 0
2: 1
3: 16
4: 106
Right 1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080281504 Original CRISPR AGGCACCTACAGCTTATTAA GGG Intronic
908051363 1:60235127-60235149 AGGCAGCCACAATTTATTAAAGG - Intergenic
909187305 1:72503863-72503885 AGGAATTTACAGTTTATTAAGGG - Intergenic
917597037 1:176539491-176539513 AGGGACATACAGCTAAATAAGGG + Intronic
918240428 1:182615659-182615681 AGGCACGTACTGTTTATGAATGG - Intergenic
918441841 1:184575810-184575832 AGGCGCCTACACTGTATTAAGGG - Intronic
923897703 1:238291271-238291293 AGGGACTTACAGCTTAGTGAAGG + Intergenic
1064498484 10:15941527-15941549 TGGGACCTAAAGCTTATTCAGGG + Intergenic
1072166402 10:92817598-92817620 AGGCTCCTGGAGCTTATTCATGG - Intergenic
1076313586 10:129525480-129525502 AGGCACGTGCGTCTTATTAAAGG - Intronic
1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG + Intronic
1081439348 11:43063323-43063345 AGGTGCCTACAGCTTTTTCAGGG - Intergenic
1085853603 11:80150592-80150614 AGGGACCCAGAGCTTAGTAAAGG + Intergenic
1088792137 11:113235426-113235448 AGGCACCAACACATTATTAAAGG + Intronic
1090500762 11:127258364-127258386 TGGCAGCTACAGCTAAATAATGG - Intergenic
1098741951 12:74184329-74184351 AGGACTCAACAGCTTATTAAAGG + Intergenic
1103036597 12:117662013-117662035 AGGCCCCAGCAGCTTTTTAATGG - Intronic
1111524403 13:89449919-89449941 ATACACCTTCAGCTTATTATGGG + Intergenic
1116383406 14:44300217-44300239 AGGCACCTAGAGATAAATAATGG + Intergenic
1119775033 14:77243040-77243062 AGGCACCTGCAGCTTCTCGATGG - Exonic
1121256241 14:92532401-92532423 AGGCATCTAGAGCTTAACAATGG - Intronic
1126140803 15:45436968-45436990 AGGCTCTTACAGCTTAGGAAAGG + Intronic
1135070149 16:19344863-19344885 AGAATCCTACAGCTAATTAAAGG - Intergenic
1137697331 16:50469916-50469938 AGGCAGCGACAGCTTAATAAAGG - Intergenic
1140026037 16:71290938-71290960 TGACACATACAGCCTATTAATGG - Intergenic
1140891143 16:79286133-79286155 AGCTAGCTACTGCTTATTAAGGG - Intergenic
1140955685 16:79862828-79862850 AGCCACGTACGGCTTATTATGGG - Intergenic
1143373839 17:6455871-6455893 AGGCACCTCCAGCTTCTCCAAGG + Intronic
1144806988 17:17974547-17974569 AAGCACCTAGGGCTTAATAAGGG - Intronic
1150161238 17:62900055-62900077 AGGAACCTACAGTCTAGTAAGGG + Intergenic
1157886356 18:51370486-51370508 TAACACGTACAGCTTATTAAAGG - Intergenic
1162678193 19:12316451-12316473 GGGCACCTACAGCTTCTACAAGG + Intergenic
1166213242 19:41320538-41320560 AGACCCCCACAGCTTGTTAAGGG - Intronic
1166441608 19:42820392-42820414 AGGCACCTCAAACTTATTTAAGG + Intronic
1166449745 19:42888382-42888404 AGGCACCTGAAACTTATTTAAGG + Intronic
1166461045 19:42988680-42988702 AGGCACCTGAAACTTATTTAAGG + Intronic
930078798 2:47430551-47430573 ATGCATCTACAGTTTATTACAGG + Intronic
932054488 2:68430938-68430960 AGGTACATTCAGCTTGTTAAAGG + Intergenic
933673894 2:85035991-85036013 AAGGACATACAGCTTAGTAAGGG + Intronic
939351218 2:141040522-141040544 AGGCACATACAGCAGATTACAGG - Intronic
943657122 2:190521590-190521612 AGGCACAGGCAGCTTTTTAAAGG - Intronic
949751088 3:7353494-7353516 AGGCATCTCCAGCTCATTCATGG - Intronic
950043728 3:9936339-9936361 AGGCACTTCCAGCTTTGTAATGG + Intronic
951259291 3:20487558-20487580 AGGGACATAGGGCTTATTAATGG + Intergenic
954908863 3:54086835-54086857 AGGCACTTACAGTTTCTGAAAGG - Intergenic
956540708 3:70335613-70335635 AGACACCTACAGTATATCAATGG - Intergenic
956985863 3:74699629-74699651 AGGCACTTAGTGCTTATCAAAGG - Intergenic
957661034 3:83153871-83153893 AGGCCACTACAGTTTACTAAAGG - Intergenic
964402301 3:156311937-156311959 AGGGACATGCAGCTTATGAATGG - Intronic
973211458 4:47619610-47619632 AGGCACGTACATAATATTAAAGG - Intronic
976026937 4:80699286-80699308 AGCCACCTACAGCCTATCAGAGG - Intronic
976083388 4:81381363-81381385 ATGCCCCTACAGCTATTTAAAGG - Intergenic
980919033 4:139063978-139064000 TGGCACCTAGAGGTTATGAAGGG - Intronic
990315421 5:54578518-54578540 AGGCACCATCAGTTAATTAAAGG + Intergenic
992384286 5:76268661-76268683 AAACACCCACAGCTTATAAATGG - Intronic
999260562 5:150236013-150236035 GGGCACATATGGCTTATTAATGG - Intronic
1002553286 5:180014350-180014372 CGGCAGCTTCAGCTTATGAAAGG - Intronic
1002717397 5:181236112-181236134 AAGCAACTACAGCATATTGAAGG - Intergenic
1003470176 6:6422170-6422192 AGGCATCTCCAGCTTCTTCACGG + Intergenic
1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG + Intronic
1010480994 6:76354025-76354047 AGGCACCAAAAGCTTATTGAAGG - Intergenic
1010957232 6:82103677-82103699 AGGCTCCCACACCTTAATAATGG + Intergenic
1022019654 7:26386111-26386133 ATGAACCTACTGCTAATTAATGG + Intergenic
1022033732 7:26515410-26515432 AGGGCCCAACAGCATATTAATGG - Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1028007683 7:85596971-85596993 AGGCACGCACACCTCATTAAAGG - Intergenic
1029891114 7:103931463-103931485 AGGCACTTACACCTTACCAAGGG - Intronic
1030017984 7:105243961-105243983 AGGCACACTCATCTTATTAATGG - Intronic
1030274102 7:107701044-107701066 TGGCACCTAAAGCTTATTAATGG - Intronic
1032326046 7:130928865-130928887 AGGAAAGTACAGCTTATAAATGG - Intergenic
1033934269 7:146563810-146563832 AGTCATCCACAGCTTATAAAGGG - Intronic
1034089877 7:148353886-148353908 AGACACCAAAAACTTATTAATGG - Intronic
1036206690 8:6810907-6810929 GGGAACCTACAGCTCATAAAAGG + Exonic
1036455777 8:8905813-8905835 AGGCAACTCCAGACTATTAAGGG + Intergenic
1038373398 8:27014099-27014121 AGGCACTTACAGTCTAGTAAAGG + Intergenic
1039956647 8:42212504-42212526 AGGAACCTATAGCTTATCAAAGG - Intergenic
1041818027 8:61996695-61996717 AGGCTCCCACAGATTAATAATGG + Intergenic
1047311482 8:123696262-123696284 AGTCACCTAGAGTTTTTTAAAGG + Intronic
1049282665 8:141758417-141758439 AGGCAGCTGCAGCTTTTAAAAGG - Intergenic
1050971848 9:11887763-11887785 AGGCAACTACAGCTTCTTTTGGG - Intergenic
1055605929 9:77970424-77970446 AGGCACCTATGGCTTTTCAAAGG + Intronic
1056389080 9:86123921-86123943 AGTCAGCTACAGTTAATTAATGG + Intergenic
1058055478 9:100444413-100444435 GGGCCCCCACAGCTAATTAATGG + Intronic
1058920878 9:109613545-109613567 AGGCACCTAAGGCATATAAAGGG - Intergenic
1194659073 X:96608684-96608706 AGGCACTTTCAGCCTATCAAAGG - Intergenic
1195919468 X:109968264-109968286 GGGCACATACAGTATATTAAGGG - Intergenic