ID: 1080282178

View in Genome Browser
Species Human (GRCh38)
Location 11:30569905-30569927
Sequence CTAAAGTCAAGCCCAAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080282171_1080282178 19 Left 1080282171 11:30569863-30569885 CCCTGTTGACTGAAGTCTAGGGA 0: 1
1: 0
2: 1
3: 26
4: 216
Right 1080282178 11:30569905-30569927 CTAAAGTCAAGCCCAAGGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 132
1080282172_1080282178 18 Left 1080282172 11:30569864-30569886 CCTGTTGACTGAAGTCTAGGGAT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1080282178 11:30569905-30569927 CTAAAGTCAAGCCCAAGGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 132
1080282174_1080282178 -10 Left 1080282174 11:30569892-30569914 CCTGCTCCCGGTGCTAAAGTCAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1080282178 11:30569905-30569927 CTAAAGTCAAGCCCAAGGTCAGG 0: 1
1: 0
2: 2
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080282178 Original CRISPR CTAAAGTCAAGCCCAAGGTC AGG Intronic
901184944 1:7366944-7366966 CCAGAGTGAAGCCAAAGGTCAGG - Intronic
903541041 1:24096480-24096502 CCAGAGTCAAGCCCAAGGTCAGG - Intronic
903659137 1:24966245-24966267 CTGGTGTCATGCCCAAGGTCGGG - Intergenic
905286676 1:36884889-36884911 CTTAGGTCATGTCCAAGGTCTGG + Intronic
905745821 1:40416545-40416567 GTGAAGTCTAGCTCAAGGTCTGG + Intronic
912519571 1:110235745-110235767 CTGGAGTCGAGCCCAAGGTAGGG + Intronic
914252103 1:145930096-145930118 CTGAAGTTTAGCCCAATGTCTGG + Intergenic
915748466 1:158182872-158182894 ATACAGTGAAGCCCAAGGCCTGG + Exonic
917011892 1:170483922-170483944 CTAAACTCAAGCCCTATCTCTGG + Intergenic
918921422 1:190715992-190716014 ATAAAGACAAACCCAAGATCAGG - Intergenic
920420660 1:205831061-205831083 CTAGAGTCAAACCTTAGGTCTGG + Intronic
922852083 1:228741415-228741437 ATAAAGGCAAGCACAAGGGCTGG - Intronic
923128912 1:231057730-231057752 GTAAAGTCAAGCCCAAAGGTGGG + Intergenic
924880219 1:248152724-248152746 CAAAAGACAGGCCCATGGTCTGG - Intergenic
1065376388 10:25047669-25047691 CCAAACTCAAGCTCAAGATCTGG - Intronic
1067470900 10:46536944-46536966 CTCATGTCAAGCCCAGGGACTGG - Intergenic
1068274141 10:54770686-54770708 CCTAAGTCAAGCACAAGGCCAGG - Intronic
1070915591 10:80152515-80152537 CAAATGTCATGCCCAGGGTCAGG + Exonic
1072860140 10:98994886-98994908 CCAAAGTCAAGCCAAGGGTAGGG + Intronic
1074278120 10:112024134-112024156 CAAAAGTCTAGCCCAGGGCCAGG + Intergenic
1074999715 10:118786648-118786670 CTAAAGCCCAGTCCATGGTCAGG - Intergenic
1075429349 10:122367283-122367305 CTAAAGTCATGCCCAGTTTCTGG + Intergenic
1080282178 11:30569905-30569927 CTAAAGTCAAGCCCAAGGTCAGG + Intronic
1080339908 11:31250446-31250468 CTAAAGTCAAGCCCCAGGCAGGG - Intronic
1080807159 11:35663649-35663671 CTCAAATCAAGCCCATGGTCCGG - Exonic
1084564554 11:69921631-69921653 ATAAAATCCAGCCCGAGGTCTGG - Intergenic
1084901975 11:72316402-72316424 CTGAAATCAAGCCCAAGGAGTGG + Intronic
1088183176 11:107135144-107135166 CTAATGTAAATCCCAAGGTTTGG + Intergenic
1088626343 11:111733108-111733130 CTCAGGCCAAACCCAAGGTCAGG + Intronic
1089624196 11:119741033-119741055 CTGAAGTCCAGCCCAGGGCCTGG + Intergenic
1093474470 12:19539399-19539421 CTAATGTCTAGCACAAGGCCTGG - Intronic
1098296230 12:69006767-69006789 CTAAAGTCAAACCAAAGTTTTGG + Intergenic
1101292852 12:103388981-103389003 CTAAACTCAACCCCAGGGGCTGG - Intronic
1102982057 12:117249851-117249873 CTACAGCCAAGACCAAGTTCTGG - Intronic
1103841323 12:123867643-123867665 CTAAAGACAAGCTCACGGTAGGG + Intronic
1104025772 12:125025094-125025116 TGAAAGTGAAGCCCAGGGTCAGG - Exonic
1107310570 13:39073271-39073293 CAAAATTCAAGCCAAAGGTGGGG - Intergenic
1109196987 13:59389280-59389302 CTAAAGTCAAGACAAAGGAAAGG - Intergenic
1109658553 13:65427938-65427960 CTGAGGTGAAGCCCAAGGTCTGG + Intergenic
1110011060 13:70334112-70334134 ATAAATTTTAGCCCAAGGTCTGG - Intergenic
1110310002 13:74037888-74037910 CTAATGTAAAGCACAAGGTCAGG + Intronic
1110755679 13:79171383-79171405 CCAAAGTGAAGCCAGAGGTCGGG + Intergenic
1110768575 13:79308149-79308171 CAAATGTCATGCCCAGGGTCAGG - Intergenic
1112114724 13:96339534-96339556 CTAAAGTAAAAGCCAAGGGCAGG + Intronic
1113721317 13:112559831-112559853 CTAAAGTCAAGATGCAGGTCTGG + Intronic
1117012175 14:51482190-51482212 CTGAAGTGAAGTCCAAAGTCAGG - Intergenic
1117365345 14:55021805-55021827 CTTAAGTCATGCACAACGTCTGG + Intronic
1118750548 14:68804936-68804958 CTAAAATCAGGAACAAGGTCAGG - Intergenic
1120420754 14:84283203-84283225 CTAAAGTCACTCCCCTGGTCAGG - Intergenic
1122073668 14:99221869-99221891 CTAGGGTCTAGCCCAGGGTCTGG + Intronic
1135143880 16:19944721-19944743 CTAAAGTCCTGCCCCAGGCCGGG - Intergenic
1137013129 16:35344297-35344319 GCAAAGTCCAGCCCAAGGTGAGG - Intergenic
1139101200 16:63769444-63769466 TTAAAGTCAGTTCCAAGGTCAGG - Intergenic
1140548153 16:75832564-75832586 CTAAAGTCAAGACAAAGGAAAGG - Intergenic
1145395665 17:22492358-22492380 CTAAAGTCAACCCGCAGGTTTGG + Intergenic
1145820390 17:27829403-27829425 CCAAAGTCAAGTCAAAGGACAGG - Intronic
1145821551 17:27840420-27840442 CCAAAGTCAAGTCAAAGGACAGG + Intronic
1146099429 17:29965130-29965152 AAAAAGTCAAATCCAAGGTCAGG - Intronic
1147916696 17:43891980-43892002 CTACAGACAAGGCCAAGGTGAGG - Intronic
1148498369 17:48069300-48069322 ATAAAGGCAAGTCCAAGGCCAGG + Intergenic
1149374981 17:56034773-56034795 CTAAACTCAAGCTCTAGGTAAGG + Intergenic
1149853659 17:60058723-60058745 CTGAAGTCAATCCAAGGGTCTGG - Intronic
1156191133 18:34721820-34721842 CTAAACTCAAGGGCAATGTCAGG - Intronic
1157676268 18:49570972-49570994 CTAGACTCAAGCCCAGGGACAGG - Intronic
1158080124 18:53579965-53579987 GTAATGTCAAGACAAAGGTCAGG - Intergenic
1160438481 18:78869383-78869405 CTAAAGGCAGGCCCAGGCTCCGG + Intergenic
1161574820 19:5049452-5049474 CAAAAACCAAGACCAAGGTCAGG - Intronic
1162308895 19:9893100-9893122 CTAGAGTCAAGCCCAAGCCTTGG - Intronic
1166020340 19:40022930-40022952 CTAAAGTCAGACTCAAGGTAAGG - Intergenic
1166722874 19:45007560-45007582 CTAAAATCATGCCCATGGCCAGG + Intronic
925331418 2:3061682-3061704 CAAAGGTCAAGGTCAAGGTCAGG + Intergenic
926056664 2:9777745-9777767 CCAAAGGCAAGGCCAAGGACAGG - Intergenic
926783959 2:16501877-16501899 CTAAAGCAGAGCTCAAGGTCAGG - Intergenic
927109143 2:19851768-19851790 CTAAAGTAAAACCCAAAGTTGGG + Intergenic
930679451 2:54240876-54240898 CTAAAGTAAAGTACAAGATCTGG - Intronic
931240693 2:60449846-60449868 CAAAAGTCTAGCCCTAGGCCAGG + Intergenic
931993696 2:67818898-67818920 CTAAAATCAGGAACAAGGTCAGG + Intergenic
940503431 2:154523403-154523425 GTAAAGACAAGCCCAAGGCCTGG - Intergenic
942807830 2:179954640-179954662 CTAAAGTCAAGTACATGTTCAGG - Intronic
943643134 2:190380729-190380751 CTCAAGGCTAGCCCAAGTTCTGG + Intergenic
947911947 2:233807434-233807456 CCAAGGTGAAGCCCAAGGCCCGG - Exonic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948567438 2:238895944-238895966 CTGAAGCCAAGCCCAAGCTGAGG + Intronic
1169376872 20:5073383-5073405 CCAAAGCCAAGCCCCAGGGCAGG - Intronic
1169789783 20:9397660-9397682 GTAATGTCAAACCCAAGGACTGG - Intronic
1175483707 20:59329640-59329662 CTGAACTCAAGCCAGAGGTCAGG + Intergenic
1179666037 21:42913164-42913186 CTAGAATAAAGGCCAAGGTCAGG - Intronic
1180867246 22:19126668-19126690 CCAAAGTCAAACCCAAGGCTAGG + Intergenic
1182852168 22:33484732-33484754 CTAAAGCCATGCCCCCGGTCTGG + Intronic
1183550432 22:38479812-38479834 CAGAAGGCAAGCCCAGGGTCTGG - Intronic
955524311 3:59805039-59805061 CTAGAGACAAACCCAAGGCCTGG - Intronic
957287702 3:78238512-78238534 CTAATGCCAAGCACAATGTCTGG - Intergenic
958483199 3:94671227-94671249 CTAAAGTCAAGAACAAGGCAAGG + Intergenic
961168034 3:124777063-124777085 CCACAGCCTAGCCCAAGGTCAGG + Intronic
967326905 3:188250141-188250163 GTACAGTCCAGCCTAAGGTCAGG + Intronic
969268345 4:6080835-6080857 CCAAAGCCAAGCCCAAGGTGGGG + Intronic
972670200 4:41207778-41207800 CTCAACTCAATCCCAAGGGCAGG + Intronic
975430965 4:74290202-74290224 CAATAGTCAAGCATAAGGTCAGG + Intronic
975773890 4:77761698-77761720 CTAAAATCAAGAACAAGGTAAGG + Intronic
979253771 4:118591528-118591550 TGAAAGTCCAGCCCAAGCTCAGG - Intergenic
979384431 4:120047644-120047666 CTAAAGTGAATCTCAATGTCAGG - Intergenic
979712534 4:123797070-123797092 CTAAAGTCAAGACAAAGGAAAGG - Intergenic
980836892 4:138205594-138205616 CTAAAATCTAGTCCAAGGCCTGG - Intronic
981994414 4:150960279-150960301 CTAGAGTCTAGCCAAAGGTATGG + Intronic
984347349 4:178546491-178546513 GTAAATTCCAGCCCAAGGGCAGG + Intergenic
984533935 4:180949572-180949594 CAAAAGACAAGCCCAATGTTAGG + Intergenic
986769889 5:10962986-10963008 CAAATGTCAGGCCCAGGGTCAGG - Intergenic
988924229 5:35973006-35973028 CTAAAGTCAAGGCAATGATCAGG + Intronic
997633028 5:135384426-135384448 ATATAGTCAAGCCCAATGGCTGG + Intronic
997699747 5:135888750-135888772 CTAAAGTCAACCCCAGGGGAAGG - Intergenic
997704685 5:135937493-135937515 TTGAAATCAAGCCCAAGGTCTGG - Intronic
999715035 5:154353591-154353613 CTAAAGTCTAGCCCAAGGCCTGG - Intronic
1001330928 5:170761848-170761870 CCAAAGTCAAGCCCAGCGCCGGG - Intergenic
1004821153 6:19369157-19369179 CTAAAGTCAGGCAAAAGGTCAGG + Intergenic
1006098704 6:31672171-31672193 CAAAAGACAAGCCCAGGTTCAGG - Exonic
1007517025 6:42420738-42420760 CTAAAGTCAATCCCAACTCCTGG - Intronic
1012249474 6:96963814-96963836 CTGAGGTCATGCCCAAGGACAGG + Intronic
1015525178 6:134168907-134168929 CTGAAGACAAGCCAAATGTCAGG + Intergenic
1017164589 6:151395724-151395746 CTTAAGTCCAGCCCAAACTCAGG + Intergenic
1017285961 6:152676863-152676885 AGAAAGTCTAGCCCAGGGTCTGG + Intergenic
1019560233 7:1652191-1652213 ATAAAGTCAAGCTCCAGGGCTGG + Intergenic
1029959655 7:104676239-104676261 CTAAAGGCAAAACCAAGATCAGG + Intronic
1030395834 7:108985646-108985668 CTGAAGCAAAGCCCAAGGTGAGG - Intergenic
1030972473 7:116076983-116077005 CTAAAGTCAAGACAAAGGAAAGG + Intronic
1036711576 8:11082845-11082867 CTGAAGACAAGCCCAAGAGCAGG + Intronic
1038259087 8:25977939-25977961 CTCAAGTCAAACCAAAAGTCAGG - Intronic
1040002163 8:42586699-42586721 CTAAAGTCATCTCCAAGGCCGGG + Intergenic
1044575113 8:93759941-93759963 CTAAAGTACATGCCAAGGTCAGG - Intronic
1047248118 8:123161470-123161492 CGAAACTCAAACTCAAGGTCAGG + Intergenic
1051242901 9:15079164-15079186 CTTAAGTGTAGCCCAGGGTCGGG + Intergenic
1056590679 9:87963822-87963844 CTAGAATCTAGCCCAAGGTAGGG - Intergenic
1060981358 9:127794274-127794296 ATAAAGCCAGCCCCAAGGTCTGG + Intergenic
1062480544 9:136748868-136748890 CCAAGGTCAAGCCCAAGGAGAGG + Intergenic
1062528837 9:136990832-136990854 ATAAAGTCCAGCCCAAGGGGAGG + Intergenic
1186800310 X:13085944-13085966 CTAAACTCAAGCCCAAGAAGAGG - Intergenic
1187287252 X:17917382-17917404 CTAATGTCAAGTCCAATGTCAGG - Intergenic
1189638231 X:43036170-43036192 ATAAAGTAAAGCCCAAGGCCAGG - Intergenic
1192497677 X:71626959-71626981 GTAAAGTCCAGCCCAGAGTCAGG - Intergenic
1198077000 X:133203526-133203548 CCAAAATCAACCCCAAGTTCAGG - Intergenic
1199587010 X:149425120-149425142 CTAAAGTCAAGACAAAGGAAAGG + Intergenic
1200384527 X:155876939-155876961 CTAAGGGCAAGCCCAAGGCTTGG - Intergenic
1200771326 Y:7128079-7128101 CTAAAGTCCAGACCAAGGAGAGG - Intergenic
1201399608 Y:13591044-13591066 GTAAATTCTAGCCCAAGATCAGG + Intergenic
1202259178 Y:22951692-22951714 CTAAAGTCAAGCCCAGCCACGGG + Intergenic
1202412164 Y:24585436-24585458 CTAAAGTCAAGCCCAGCCACGGG + Intergenic
1202458616 Y:25084632-25084654 CTAAAGTCAAGCCCAGCCACGGG - Intergenic