ID: 1080290842

View in Genome Browser
Species Human (GRCh38)
Location 11:30669903-30669925
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080290842_1080290847 -8 Left 1080290842 11:30669903-30669925 CCTAGCCCCACCTTTTGCTACAG No data
Right 1080290847 11:30669918-30669940 TGCTACAGCCACTGCCGTCCTGG No data
1080290842_1080290850 7 Left 1080290842 11:30669903-30669925 CCTAGCCCCACCTTTTGCTACAG No data
Right 1080290850 11:30669933-30669955 CGTCCTGGCCATTTCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080290842 Original CRISPR CTGTAGCAAAAGGTGGGGCT AGG (reversed) Intergenic
No off target data available for this crispr