ID: 1080297336

View in Genome Browser
Species Human (GRCh38)
Location 11:30745346-30745368
Sequence GCTTCCTGGAACCTATACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080297336_1080297341 29 Left 1080297336 11:30745346-30745368 CCCTAGTATAGGTTCCAGGAAGC No data
Right 1080297341 11:30745398-30745420 CTTGCCACCTGATTCTCATGTGG No data
1080297336_1080297342 30 Left 1080297336 11:30745346-30745368 CCCTAGTATAGGTTCCAGGAAGC No data
Right 1080297342 11:30745399-30745421 TTGCCACCTGATTCTCATGTGGG No data
1080297336_1080297339 2 Left 1080297336 11:30745346-30745368 CCCTAGTATAGGTTCCAGGAAGC No data
Right 1080297339 11:30745371-30745393 AACCTTACAGAGAGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080297336 Original CRISPR GCTTCCTGGAACCTATACTA GGG (reversed) Intergenic
No off target data available for this crispr