ID: 1080297937

View in Genome Browser
Species Human (GRCh38)
Location 11:30751697-30751719
Sequence CTGTGGTCACATATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080297937_1080297941 14 Left 1080297937 11:30751697-30751719 CCTAGCTCCATATGTGACCACAG No data
Right 1080297941 11:30751734-30751756 GCATATTTACAAGCATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080297937 Original CRISPR CTGTGGTCACATATGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr