ID: 1080299868

View in Genome Browser
Species Human (GRCh38)
Location 11:30772024-30772046
Sequence AAACGTAAACAGCTCTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080299868_1080299872 21 Left 1080299868 11:30772024-30772046 CCTTGAAAGAGCTGTTTACGTTT No data
Right 1080299872 11:30772068-30772090 GCCCCCTTTTTTGAGTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080299868 Original CRISPR AAACGTAAACAGCTCTTTCA AGG (reversed) Intergenic
No off target data available for this crispr