ID: 1080304945

View in Genome Browser
Species Human (GRCh38)
Location 11:30826056-30826078
Sequence GCTGCTGCTGCTCTGAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080304939_1080304945 27 Left 1080304939 11:30826006-30826028 CCACAAGGGTTTGTGGGTAAAAG No data
Right 1080304945 11:30826056-30826078 GCTGCTGCTGCTCTGAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080304945 Original CRISPR GCTGCTGCTGCTCTGAGTCT GGG Intergenic
No off target data available for this crispr