ID: 1080307970

View in Genome Browser
Species Human (GRCh38)
Location 11:30857227-30857249
Sequence TAAGAGAAGTATAGTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080307970 Original CRISPR TAAGAGAAGTATAGTGAAGT GGG Intronic
905361940 1:37426845-37426867 TAATAGAAGTAGTGTGAAGCTGG - Intergenic
905442451 1:38004151-38004173 TCAGAGAAGTTTAGGGAAGGGGG + Intronic
907148539 1:52259842-52259864 AAAGAAAAATATAGTCAAGTTGG - Intronic
908088347 1:60660622-60660644 AAAGAGGAGTCTGGTGAAGTAGG - Intergenic
908867396 1:68565634-68565656 TAAGAAAATTGTAGTGAAATGGG - Intergenic
910178562 1:84457227-84457249 GAAGAGAAGGAGAGTGAAGAAGG + Intergenic
911026471 1:93440817-93440839 AAAGAGAAGTAGTGAGAAGTAGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916698532 1:167266078-167266100 CAAGAGAACTATTGTGAAGGTGG - Intronic
918435534 1:184507937-184507959 TAAGGGAAAAATAATGAAGTAGG + Intronic
919646852 1:200103807-200103829 GAAGAGAAGTCTAGGGAATTTGG + Intronic
919723893 1:200869768-200869790 AAAGAGCAGTCTTGTGAAGTTGG + Intergenic
921410594 1:214832387-214832409 CAAGAAAAAAATAGTGAAGTGGG - Intergenic
921428819 1:215039265-215039287 AAAGAGGAGTATATTCAAGTTGG - Intronic
923813577 1:237347919-237347941 TAAGAGAAGTGCACTGAGGTAGG + Intronic
1065464489 10:26004356-26004378 GAAAAGAATTATAGTGATGTTGG + Intronic
1068322064 10:55432524-55432546 TAAGAGAACAATAGTGACTTGGG + Intronic
1071994277 10:91131476-91131498 TAAGAGAACTTGAGTGTAGTTGG - Intergenic
1072844223 10:98811086-98811108 TAAGAGAAGGTTAATGTAGTTGG - Intronic
1073040845 10:100604027-100604049 TAAAAGAATTATAATGTAGTGGG + Intergenic
1074931180 10:118127828-118127850 TAAGAAAAGTCTAGTGATGGGGG - Intergenic
1075412871 10:122241932-122241954 TAAGAGAAGTAAAGACACGTTGG - Intronic
1075920702 10:126210588-126210610 TAAAAGAAGTCCAGTGAAGAAGG + Intronic
1076270659 10:129149579-129149601 AAAAAGAAGGAAAGTGAAGTAGG - Intergenic
1077816460 11:5690590-5690612 GAAGAGAAGAAAAGTGAAGTGGG + Intronic
1079767118 11:24407616-24407638 AAAGTTAAGTATAGTGCAGTAGG - Intergenic
1079844066 11:25442100-25442122 GAAGAGAGGTATACTGAAATGGG - Intergenic
1080307970 11:30857227-30857249 TAAGAGAAGTATAGTGAAGTGGG + Intronic
1081251157 11:40836181-40836203 TAAGAGAAGATTGGTGAGGTTGG - Intronic
1085921146 11:80958573-80958595 TGAGACAAGTATAGAGAAATAGG + Intergenic
1086208096 11:84284541-84284563 TGAGAGAAGTTGACTGAAGTAGG + Intronic
1086452032 11:86926633-86926655 TAAGAGATGCATAGAGAAGCAGG - Intronic
1087937356 11:104050319-104050341 TAAAAGAAGTGAAGGGAAGTAGG + Intronic
1089772298 11:120812266-120812288 TAAGAGGAGTAAAGTAGAGTGGG + Intronic
1090905965 11:131074753-131074775 TAAGAGAAGGGTGGAGAAGTGGG - Intergenic
1093383457 12:18522023-18522045 GAAGAGCAGTATGGTGCAGTGGG - Intronic
1094053949 12:26249627-26249649 TAAGTGAAGGATCTTGAAGTGGG + Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1098106387 12:67071808-67071830 AAAGAAAAGTATAGTTTAGTAGG + Intergenic
1099831016 12:87842798-87842820 TCAGAGAAAGATTGTGAAGTGGG + Intergenic
1101293677 12:103398358-103398380 TAAGAGAAAGATAGTTAACTGGG - Intronic
1104297556 12:127530966-127530988 AAAGAGAAATATAGTGGAGAGGG + Intergenic
1106736665 13:32594417-32594439 CAAGAGATGTATATTCAAGTGGG + Intronic
1106740303 13:32633994-32634016 GGAGAGAAGTATAGTTTAGTAGG - Intronic
1108256686 13:48618065-48618087 TAAGAGAAGGAGAATGAAGGGGG + Intergenic
1109467275 13:62752366-62752388 GAAGAGAAGTATATTGTAGAGGG - Intergenic
1109483538 13:62988557-62988579 TAAGAGAAGCTTAAAGAAGTGGG - Intergenic
1109553671 13:63940815-63940837 TAAGAGAAGTACAGAGAACTGGG + Intergenic
1110454079 13:75670199-75670221 TCAGAAAAGTATGCTGAAGTAGG + Intronic
1112970128 13:105251616-105251638 ACAGATAAGTAGAGTGAAGTAGG + Intergenic
1114827445 14:26098508-26098530 TGAGAGAAGTATAGTGAGCGGGG - Intergenic
1115094598 14:29619645-29619667 TAAGAGAAGTATGGAGAAGGGGG + Intronic
1116067038 14:39997541-39997563 TAAGCAAAGAAGAGTGAAGTAGG + Intergenic
1118459216 14:65973517-65973539 CAAGAGCAGGAAAGTGAAGTGGG + Intronic
1118758291 14:68861477-68861499 TAAGAGAAGTAAAGACAACTGGG - Intergenic
1119608434 14:76041267-76041289 CAAGAGTAGTATTGTAAAGTTGG + Intronic
1119829346 14:77687195-77687217 TTAGAGAAGTTTAGTGGTGTGGG - Intronic
1120061435 14:79988006-79988028 CAAGAAAATTATTGTGAAGTAGG - Intergenic
1120188605 14:81419827-81419849 TAAGAGAAGAGAAGTGAAGTAGG + Intronic
1120342818 14:83244070-83244092 TAAGAGGAAAAGAGTGAAGTGGG - Intergenic
1125096356 15:35856794-35856816 CAAGAGAAGTACATTGAAGATGG + Intergenic
1127414191 15:58741375-58741397 TTATAGAAGTTTAGTGAATTTGG - Intronic
1128053033 15:64680362-64680384 TAAGAAAAGTACAGTGATGCTGG + Intronic
1130408523 15:83624577-83624599 GAGGACAAGTACAGTGAAGTGGG + Intergenic
1131558868 15:93422500-93422522 AAAGAGAAGAAAAGTGATGTGGG - Intergenic
1134856900 16:17527579-17527601 TGAGAGAAGTCTAGTGCAGTGGG - Intergenic
1135428945 16:22365532-22365554 GAAGAGAAGTAGAGTGACCTGGG - Intronic
1136144022 16:28305077-28305099 ACAGAGAAGTAAAGTGAAGCAGG - Intronic
1138582031 16:57947939-57947961 TAACAGAAGCAAAGTGGAGTTGG + Intronic
1139873232 16:70124445-70124467 TATGAGAACAATAGTGAAGATGG - Intronic
1140283045 16:73573104-73573126 TAAGAGAGTTATAGTGAATGAGG + Intergenic
1143716311 17:8772392-8772414 AAAGAGAAGTACAGTGAGATTGG - Intergenic
1143940221 17:10533158-10533180 TAAGAGTCCTATAATGAAGTGGG - Intronic
1146137110 17:30332160-30332182 TAAGGGAAAAATAGTGCAGTTGG + Intronic
1146385647 17:32370007-32370029 GAAGTGAAGTATAGTAAATTTGG + Exonic
1149564570 17:57631836-57631858 TAAGAGAGGCATAGCAAAGTGGG + Intronic
1150225028 17:63519847-63519869 TAAGAGCTGAATGGTGAAGTTGG + Intronic
1155604158 18:27584765-27584787 TGAAAGAAGTATAGTCAAGTGGG + Intergenic
1155786305 18:29905574-29905596 CAAGAGAACTATAGTGTAGCAGG + Intergenic
1156002858 18:32405164-32405186 TAAGAGAAGTACAGTGGTTTGGG - Intronic
1156264893 18:35478776-35478798 TGAAAGAAGTACAGTGGAGTAGG + Intronic
1157254096 18:46122684-46122706 TGAGAGGACTATAGAGAAGTTGG + Intronic
1157536786 18:48465151-48465173 TAAGAGAATTCTACTGAATTTGG + Intergenic
1158225425 18:55196455-55196477 TAATAGAATTAGAGAGAAGTGGG + Intergenic
1158671699 18:59480501-59480523 TAATATAAGTATCTTGAAGTCGG - Intronic
1159465021 18:68770472-68770494 TAAGACAAGTTTATTGAATTGGG + Intronic
1159510606 18:69394182-69394204 TAACAGAAATGTAGTGATGTCGG + Intergenic
1167739381 19:51315042-51315064 TAAGGGAGGTATGGTTAAGTGGG - Intronic
1168711007 19:58499884-58499906 AGAGAGAAGTATAGAGAAGGCGG + Intronic
925514852 2:4670017-4670039 TTAGAGAAGAGTATTGAAGTGGG - Intergenic
927996861 2:27492982-27493004 TAAGAGAAATAGAGTGGAGTGGG - Intronic
929339574 2:40798235-40798257 TAACAAAAGCATTGTGAAGTGGG + Intergenic
930598110 2:53412312-53412334 GAAGAGAAGTATAGAGAAAAAGG + Intergenic
932803710 2:74765466-74765488 AAAGAAAAGTCTAGAGAAGTAGG - Intergenic
935105425 2:100039137-100039159 TGAAAGAGATATAGTGAAGTTGG - Intronic
935368762 2:102322575-102322597 GAAGAGAACTGTATTGAAGTCGG - Intronic
937177144 2:119950210-119950232 TACCTGAAGTATAGTGAATTGGG - Intronic
937293655 2:120797173-120797195 TAAGAGAATTAGAATGAAGTTGG + Intronic
937583624 2:123519593-123519615 TAAAAGAAATAGAGTGAAATTGG - Intergenic
937742472 2:125372476-125372498 TTAGAGAAGTATATTCAAATTGG + Intergenic
939073929 2:137577649-137577671 TAAGAAAAGGAAAGAGAAGTGGG - Intronic
939709392 2:145497421-145497443 GAAGTGAAGTGAAGTGAAGTGGG + Intergenic
939768100 2:146279136-146279158 CAAGAGAAGAATAGGGATGTGGG - Intergenic
940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG + Intergenic
941111351 2:161421739-161421761 TAAGAGAAGTAGAGGGAGGCAGG - Intronic
942813724 2:180026607-180026629 AAGGAGAAATAGAGTGAAGTGGG + Intergenic
944312102 2:198244885-198244907 TAAGAGGAGATTTGTGAAGTAGG - Intronic
944842034 2:203633960-203633982 GAAGTGAAGTATAGTAAATTTGG - Intergenic
946031824 2:216711434-216711456 AAAGACAGGTATAGGGAAGTGGG - Intergenic
946666948 2:222060401-222060423 TAAGAGATGGAAAGTGAACTGGG + Intergenic
947377103 2:229507284-229507306 TAATAGAAGTATAGTCATGACGG - Intronic
947417073 2:229908043-229908065 AATGATAAGTTTAGTGAAGTGGG - Intronic
948336388 2:237210767-237210789 TAAAGGAAGGATAGTAAAGTAGG + Intergenic
948523754 2:238558123-238558145 TAATCGATGTATAATGAAGTCGG - Intergenic
1169885841 20:10396557-10396579 AAAGAGAAAAATAGTGAAATAGG + Intergenic
1170108807 20:12782692-12782714 AAAGAGAAGTATAGAGAAATAGG + Intergenic
1170657568 20:18303922-18303944 AAAGAAAAGAATAGTGAACTTGG + Intronic
1170849558 20:19992664-19992686 TTAGTGAAGTATAGTTAAGATGG - Intronic
1171275708 20:23855247-23855269 TGAGAGCAGTATAGTGGTGTGGG + Intergenic
1174028872 20:47604346-47604368 TAAATGAAGCATAGTGAAGAGGG - Intronic
1176940917 21:14924629-14924651 CTAGAGAAGAATATTGAAGTTGG + Intergenic
1177456759 21:21349918-21349940 GATGGGAAGTATAGTGAGGTGGG + Intronic
1179810514 21:43866143-43866165 TGAGAGAAGTTTAGTGACATGGG + Intronic
1183143629 22:35969080-35969102 AGAGAGCAGTAAAGTGAAGTGGG + Intronic
1184051322 22:42007505-42007527 TGGGAAAAGTATGGTGAAGTGGG - Intronic
949275368 3:2273689-2273711 TAAGAGGAAAATAGTAAAGTGGG - Intronic
949857526 3:8475524-8475546 TAACAGAGGTACAATGAAGTTGG - Intergenic
949983937 3:9523769-9523791 TAAGGGAAGAATATTGAAGAAGG - Intronic
950910579 3:16585651-16585673 CAAGAGAATTTTAGTGAAGAAGG + Intergenic
951234786 3:20221335-20221357 TAAGAAAAGCACAGTGAAGCAGG - Intergenic
952103877 3:30047273-30047295 TAAGAGAAGTTTAGAGAGATGGG - Intergenic
952336303 3:32406105-32406127 TAATAAAAGTATAGAGCAGTGGG - Intronic
952654766 3:35771786-35771808 TAAGGGAATTATAGTCAAGAAGG + Intronic
957508772 3:81160148-81160170 TAAGGGTAGAAAAGTGAAGTAGG + Intergenic
957795983 3:85008142-85008164 TAACAGAAGTAGACTGGAGTTGG - Intronic
959942930 3:112098285-112098307 TCAGAAGAGTATAATGAAGTTGG - Intronic
963227244 3:142874767-142874789 TAAGAGATTTATAGTTTAGTAGG + Intronic
963398360 3:144762782-144762804 TAAAAGATGTATAGAGAAGGAGG + Intergenic
965350292 3:167603375-167603397 TTAGAGAAGGATAGAGGAGTTGG - Intronic
965418346 3:168425704-168425726 TAAGAGAGGTGTATTGAAGAAGG + Intergenic
965446240 3:168777723-168777745 TAAGAGAAGAGTATAGAAGTGGG + Intergenic
966572818 3:181465842-181465864 TAAGAGAAGTAAAGAGATGTTGG + Intergenic
967320959 3:188194616-188194638 GAAGGGAAGTATAATGATGTTGG + Intronic
967722190 3:192827476-192827498 TTAGAGAAGTCTATTGAAGCTGG + Intronic
969554121 4:7894667-7894689 GAAGAGAAGGGTGGTGAAGTGGG - Intronic
972682522 4:41320173-41320195 CAAGAGAAATATTCTGAAGTTGG - Intergenic
972683072 4:41325579-41325601 TAATATAAGTATAGTTAATTTGG + Intergenic
973756773 4:54082523-54082545 TAATAGAAATAGAGTGGAGTAGG - Intronic
973899199 4:55450430-55450452 AAAGAGAAGAAGAATGAAGTTGG + Intronic
974793981 4:66725133-66725155 TGAGAGAAGAACAGTGAAGCAGG - Intergenic
975789082 4:77928710-77928732 TAAGAGAAGTATATTTAGTTGGG + Intronic
976050017 4:81000444-81000466 TAAGAGTAGTATTGTAAAATAGG - Intergenic
976132010 4:81894678-81894700 AAAGAGAAGCAAAGTGAATTAGG + Intronic
976605162 4:86975827-86975849 TATGAGAAGTACTGTGAAGGGGG + Intronic
976678620 4:87730669-87730691 TAATAGAAGTATGCTGAAGCAGG + Intergenic
978720647 4:111904843-111904865 TAAGAGAAGGTTAATGAAATTGG + Intergenic
979588472 4:122449224-122449246 GAAGAGAAGTATAGAGGAGTAGG + Intergenic
982964828 4:161892366-161892388 TAATAGAAATATAGTGTATTTGG - Intronic
983629753 4:169837934-169837956 CCAGTGAAGTATAGTGGAGTCGG - Intergenic
984139670 4:175988189-175988211 AAAGAGAAGTGCATTGAAGTGGG - Intronic
984407800 4:179355783-179355805 CAAGAGAAGAAAAATGAAGTAGG - Intergenic
984743661 4:183192299-183192321 AAAGAGAAGGAAACTGAAGTAGG + Intronic
988859793 5:35265810-35265832 TAAGAGAAGTTCAGTGTTGTTGG + Intergenic
989254679 5:39353401-39353423 TAAGTGGAGTAAAGTAAAGTTGG - Intronic
989503048 5:42191788-42191810 TAAGATATGAAGAGTGAAGTAGG + Intergenic
989773954 5:45180612-45180634 AAAGAGAAGTAAAGTGTACTTGG + Intergenic
991005186 5:61821972-61821994 ATAGAGAATTATAGTGAAGGTGG + Intergenic
991084326 5:62634689-62634711 TAAATAAAGTATATTGAAGTAGG - Intergenic
994492805 5:100469597-100469619 TAAGATAACTATAGTGAATATGG + Intergenic
994536264 5:101033794-101033816 TAAAAGAAGTTTATTGAAGCGGG + Intergenic
996984160 5:129537960-129537982 AAAGAGTAGTAAATTGAAGTTGG + Intronic
997222026 5:132177270-132177292 TAAGGGAAGTATAATGAACCTGG + Intergenic
999389503 5:151180013-151180035 TAAGAAAAGCAAAGTGAAATTGG - Intergenic
1001372947 5:171224666-171224688 TAGGAGAAGTGAAGTGGAGTGGG + Intronic
1002954531 6:1848811-1848833 TGTGTGAAGTATAGTGAAGTGGG + Intronic
1003373270 6:5549633-5549655 TAAGAGAAGTATTTTGAGATGGG - Intronic
1003732246 6:8838240-8838262 TATGTAAAGTATAGTGAGGTGGG + Intergenic
1005789676 6:29285042-29285064 TATGAAAAGTATACTGATGTAGG + Intergenic
1005819916 6:29589261-29589283 AAACAGACATATAGTGAAGTGGG - Intronic
1005900782 6:30214602-30214624 TAAGCAATGTATAGTGGAGTGGG + Intergenic
1007813637 6:44504412-44504434 TAAAAGAAGTGTAATGAAGATGG + Intergenic
1007905615 6:45457713-45457735 TAAGTGAAGTAGAGAAAAGTAGG + Intronic
1008444166 6:51569298-51569320 AAAGAGAACTATAGTTAATTAGG - Intergenic
1008950710 6:57155593-57155615 TAAGAGAAGGAAAGGGAGGTTGG - Intronic
1010227420 6:73504090-73504112 TAATAGAAGTATTGTGGAGAGGG - Intronic
1011954679 6:93012424-93012446 TAAGGGAAGTATATTTGAGTAGG + Intergenic
1012863819 6:104594338-104594360 TAATAGAAGGATAGTCAGGTAGG + Intergenic
1014894859 6:126889564-126889586 TAAGAGAACAATAGGGTAGTGGG - Intergenic
1015771107 6:136769548-136769570 AGAGAGAAGTATACAGAAGTGGG + Intronic
1017217786 6:151930279-151930301 TTAAAGAAGTATAGTTAAGCCGG - Intronic
1018275886 6:162130998-162131020 TAAGAAAAGTATTTTGAACTCGG - Intronic
1018520913 6:164650715-164650737 GAAGAGAAGAATAGAGAAATGGG - Intergenic
1019764236 7:2837978-2838000 TAAGACATTTATAGTGAAGTGGG + Intronic
1020479368 7:8638817-8638839 TACGAGCAGTAAAGTGCAGTGGG - Intronic
1021250430 7:18318537-18318559 AAAAAGAAGTAAAGTGGAGTGGG + Intronic
1021369948 7:19832171-19832193 AAAGAGAAGTATCCTGAAATAGG - Intergenic
1022157141 7:27671947-27671969 TAAGATAAGTACAGAAAAGTCGG + Intergenic
1022183837 7:27947945-27947967 TAAGATAAGAAAAGAGAAGTAGG - Intronic
1022304755 7:29136649-29136671 TAAGAGAAGGATGGGGAGGTGGG + Intronic
1026433120 7:70367984-70368006 AAAGAGAAGCAAAGTGGAGTGGG + Intronic
1028332706 7:89615744-89615766 TAAGATGAGAATAGTGAAGAGGG - Intergenic
1028613977 7:92743994-92744016 TAAGAGATGTAGAATAAAGTGGG - Intronic
1031119420 7:117704237-117704259 TAAGAGAAGGATAGCGTAGCAGG + Intronic
1031665882 7:124481406-124481428 CAAGAAAAGTAAAGTGAATTAGG + Intergenic
1032984850 7:137326549-137326571 TAAGAGATCTATAGTGAAGTGGG + Intronic
1035551546 8:531374-531396 TAAGAGACTTATGGTGAATTGGG + Intronic
1036101210 8:5787563-5787585 TAAGAGAATAACAATGAAGTAGG + Intergenic
1038194519 8:25354595-25354617 CAAAAGAAGCAAAGTGAAGTGGG + Intronic
1039732334 8:40293540-40293562 TAAGAGTGGTTAAGTGAAGTGGG + Intergenic
1040930322 8:52727623-52727645 TCAGAGAAGCATACTTAAGTAGG + Intronic
1041046031 8:53887177-53887199 TAAGAGAAAGAAGGTGAAGTGGG - Intronic
1041117458 8:54553956-54553978 TCAGAGAAGGACAGTGAAGGTGG + Intergenic
1043217969 8:77620315-77620337 GAAGAGAAAGATAGTGAAGGGGG + Intergenic
1043258892 8:78172603-78172625 TTAGAGATGCATAGTGAACTAGG - Intergenic
1046401305 8:113707644-113707666 TAAGAAAAGTAAGGTGAAGAAGG - Intergenic
1046494779 8:114999025-114999047 AAAGAGAGGTAGAGTGAAGAAGG - Intergenic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1048843198 8:138582700-138582722 TCAGTGAAGAATAGAGAAGTTGG - Intergenic
1049305106 8:141898580-141898602 TAAGACAAGAGTAGGGAAGTGGG + Intergenic
1050469188 9:5967667-5967689 TAAGGGCAGTACAGTGTAGTAGG - Intronic
1052113086 9:24614124-24614146 TAAAGGTAGTAAAGTGAAGTAGG - Intergenic
1052259652 9:26499272-26499294 AAAAAGAAGTAGAGTGAGGTTGG + Intergenic
1053103609 9:35391773-35391795 CAAGAGAAGTAGTGTGAGGTGGG + Intronic
1053621707 9:39826153-39826175 TCAGAAAACTATAGTGAAATGGG + Intergenic
1053837642 9:42158020-42158042 TCAGAAAACTATAGTGAAATGGG + Intergenic
1053883387 9:42618144-42618166 TCAGAAAACTATAGTGAAATGGG - Intergenic
1053889282 9:42676155-42676177 TCAGAAAACTATAGTGAAATGGG + Intergenic
1054222410 9:62425611-62425633 TCAGAAAACTATAGTGAAATGGG - Intergenic
1054228303 9:62483561-62483583 TCAGAAAACTATAGTGAAATGGG + Intergenic
1055162553 9:73148143-73148165 TAAGAGACTTTTAGGGAAGTGGG - Intergenic
1057729512 9:97596534-97596556 AAACAGAAGTCTAGGGAAGTAGG + Intronic
1057970867 9:99556308-99556330 TAAGGGCAGAAAAGTGAAGTCGG + Intergenic
1058683293 9:107458608-107458630 TAAGTGAAGTTGAATGAAGTTGG - Intergenic
1058786151 9:108390269-108390291 TAAAAGAAGTATGTTGAGGTAGG - Intergenic
1060329504 9:122653694-122653716 CAAGGGAAATATTGTGAAGTTGG - Intergenic
1060368450 9:123044259-123044281 TAACAGAAGTAAAGGGAAATCGG + Intronic
1060394303 9:123304760-123304782 TAAGAGAAGAAGGGTGAAGTGGG - Intergenic
1060455003 9:123784007-123784029 AAACAGAAGTATACTGAGGTAGG + Intronic
1186798843 X:13072903-13072925 TAAAAGAATCATAGAGAAGTTGG - Intergenic
1187255278 X:17636316-17636338 ATAAAGAAGTATAGTGAAGGAGG - Intronic
1189904295 X:45742282-45742304 GGAGAGAAATATAGTGAAGATGG + Intergenic
1190133854 X:47776382-47776404 TAAGAGAAGGATAGGGAAAGAGG + Intergenic
1190626533 X:52343254-52343276 TAAGTGAAGCAGAGTGCAGTGGG + Intergenic
1192289470 X:69777712-69777734 AAAGAGAAGTTTTGTGAAATTGG + Intronic
1192630637 X:72775512-72775534 TAAAAGAAGAATAGTGAGGGGGG + Intergenic
1192651073 X:72945292-72945314 TAAAAGAAGAATAGTGAGGGGGG - Intergenic
1194497977 X:94640938-94640960 TAAAAGAAGTATAATGATGTTGG - Intergenic
1195878893 X:109572394-109572416 TCAGAGATGTATAATGCAGTTGG + Intergenic
1199554553 X:149092038-149092060 TAAGATAAGGAAAGTAAAGTTGG + Intergenic
1202300850 Y:23412282-23412304 TGAGAGCAGTTTGGTGAAGTGGG + Intergenic
1202569961 Y:26258316-26258338 TGAGAGCAGTTTGGTGAAGTGGG - Intergenic