ID: 1080310528

View in Genome Browser
Species Human (GRCh38)
Location 11:30886399-30886421
Sequence CTGCTCAGGCTGCCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080310528 Original CRISPR CTGCTCAGGCTGCCACAAAC TGG Intronic
901118821 1:6873456-6873478 TTGCTCAAGCAGCCCCAAACCGG + Intronic
901643324 1:10704144-10704166 CTCCTCAGGATGCCCCAAGCTGG - Intronic
902447590 1:16476851-16476873 CTTCTCACTCTGGCACAAACTGG - Intergenic
902879835 1:19364299-19364321 GTGCTCAGTCTGCCTCATACAGG - Intronic
903811876 1:26039137-26039159 CTGCTCAGCCAGGCACCAACTGG - Exonic
904496249 1:30888451-30888473 CTGCTCAGGCTGACTCCAGCAGG - Intronic
905514578 1:38552848-38552870 CAGCTCAGGCTGCCATAAACTGG + Intergenic
907109112 1:51910294-51910316 CAGCTCAGCCTGGCACACACGGG + Exonic
907572046 1:55492441-55492463 CTCCTGAGGATGCTACAAACAGG + Intergenic
908437637 1:64121965-64121987 CTGCACCAGCTGCCACAACCTGG + Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
909519102 1:76546764-76546786 CTGCACAGGCAGCCTCAACCTGG - Intronic
910785284 1:90990973-90990995 ATACTCAGGAGGCCACAAACAGG - Intronic
912947421 1:114096577-114096599 CACCTCAGCCTGCCAGAAACAGG + Intronic
914995610 1:152541022-152541044 CTGCAGAGCCTGCCACACACAGG + Intronic
915431140 1:155868038-155868060 CTGGTCATGCTGCCACCAGCAGG + Exonic
918053107 1:180991695-180991717 CTGCTCTGGCACCCACACACAGG - Intronic
918410716 1:184255308-184255330 ATGCTCAGGATGCCAGGAACTGG - Intergenic
920050488 1:203161965-203161987 CAGCTCAGGCAGGCACAAATGGG - Intronic
920065124 1:203263763-203263785 CTCCTCAGGCGGACACACACAGG - Intronic
921048241 1:211492327-211492349 GTGCTCAGTGTGGCACAAACTGG + Exonic
922845891 1:228683845-228683867 CTGCACAGGCAGCCAGACACGGG - Intergenic
924142334 1:241038667-241038689 CTTCTCAGGCTGGTACAAATTGG - Intronic
1063017572 10:2094169-2094191 CTGCTCAAGCAGCCACCATCCGG + Intergenic
1063604026 10:7507381-7507403 CTTCTTAGTCTGCCACAATCTGG - Intergenic
1068147353 10:53088589-53088611 CACCTCAGGCTGCAACAAGCAGG + Intergenic
1070685430 10:78476929-78476951 CTGCTCAAGCTCCCACATAAGGG - Intergenic
1071551370 10:86568729-86568751 CTGCTCACTCTGACACCAACAGG - Intergenic
1072310638 10:94150940-94150962 CAGCTCAGACTGCCAGAACCTGG - Intronic
1073099227 10:100998282-100998304 CTGGGCAGGCTGCCAGAAAGAGG + Intronic
1073107991 10:101043512-101043534 CAGCTCAGGCTGCCAGACAAAGG + Intergenic
1075062302 10:119265641-119265663 CAGCTCAGGCTGCCATAGACTGG - Intronic
1076259913 10:129057344-129057366 CTGCCCAGGCTGCCAGCACCCGG - Intergenic
1076734322 10:132451979-132452001 CTGCGCTGGCTGCCACAGTCTGG + Intergenic
1076823962 10:132958017-132958039 CTCCTCAAGCTTCCACAAACAGG + Intergenic
1077239041 11:1501083-1501105 CTCCTCAGCCTGCGACAGACAGG + Intronic
1078885314 11:15494173-15494195 ATGGTCAGGCTGGCATAAACTGG - Intergenic
1079134019 11:17765952-17765974 CTGCTCAGGCTGCCATCTCCCGG - Intronic
1079328439 11:19514034-19514056 CTCCTGGGGCTGCCACAAACTGG - Intronic
1080310528 11:30886399-30886421 CTGCTCAGGCTGCCACAAACTGG + Intronic
1081209086 11:40309826-40309848 CTGCTCAGGCCCCCAGAAGCAGG + Intronic
1082008450 11:47434460-47434482 CAGCTCAGGCTGCCATAACAAGG - Intergenic
1085622205 11:78045987-78046009 CTCCTGAGGCTGCCTCTAACTGG - Intronic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1085970970 11:81590261-81590283 GTGGTCAGGCAGGCACAAACTGG - Intergenic
1089414928 11:118280352-118280374 TTGATCAGGCTGCTCCAAACTGG + Intergenic
1090258869 11:125304430-125304452 CTTCTCAGGCTGCCACACGCTGG - Intronic
1090630891 11:128646359-128646381 TTGCTCCTGCTGCCACAAAGAGG + Intergenic
1092520708 12:9269772-9269794 CTGCTCATACTGCCACACCCTGG + Intergenic
1092930853 12:13314463-13314485 TTTCTCAGGCTGCCTCCAACAGG + Intergenic
1093960191 12:25264229-25264251 CTTTTCAGTGTGCCACAAACAGG + Intergenic
1098054652 12:66492015-66492037 TTTCTCAGGCTGGCACACACTGG - Intronic
1099738512 12:86601175-86601197 CTGCTCCCGCTGCCATCAACAGG - Intronic
1103209802 12:119157796-119157818 CTGCCCAGGCTGCCACGCCCTGG + Exonic
1104370655 12:128221179-128221201 CTGCTGGGGCTGCCAGAAAAAGG + Intergenic
1105578067 13:21671153-21671175 CCGCCCAGGCTGCCGCGAACAGG - Intergenic
1107664148 13:42671901-42671923 TTGCTCAACCTGCCACAAAAGGG + Intergenic
1107756737 13:43632027-43632049 CTGCTCAGGCTGCTCCAAGAAGG - Intronic
1111999064 13:95193330-95193352 CAGCTCAGGCTGCTTAAAACAGG - Intronic
1112195250 13:97219413-97219435 CAACTCAGGCTGCCATAGACTGG + Intergenic
1115457546 14:33622039-33622061 CTGCTCAGGCTGCTGGATACTGG - Intronic
1119878949 14:78084973-78084995 CTGTTCAGGCTGCCCTGAACTGG + Intergenic
1121605782 14:95238708-95238730 CTGCTCCAGCCGGCACAAACCGG + Intronic
1122850215 14:104524011-104524033 CTGCTCAGGAGGCCACACCCTGG - Intronic
1125596778 15:40892691-40892713 GTACTGAGTCTGCCACAAACAGG + Intergenic
1128589584 15:68883200-68883222 CTGCTAAGGCTGCCACTGTCAGG + Intronic
1129760887 15:78128809-78128831 CTGCTCAGTCTCCTGCAAACTGG - Intronic
1133857877 16:9566478-9566500 ATTCTCAGGCTGTCACAAAGTGG - Intergenic
1140218740 16:73028455-73028477 ATGCTGGGGCTGCCACACACCGG + Intronic
1140778102 16:78268682-78268704 CTCCACAGGCTTCCCCAAACTGG + Intronic
1143681685 17:8480606-8480628 CTGCTCAGGTTTCCAGCAACAGG - Intronic
1144888742 17:18481467-18481489 AATCACAGGCTGCCACAAACAGG + Intronic
1145143465 17:20462831-20462853 AATCACAGGCTGCCACAAACAGG - Intronic
1145968562 17:28939765-28939787 ATGCTTGTGCTGCCACAAACAGG + Intronic
1146256390 17:31393328-31393350 CTGCTCAGCCTGCCCCAGATGGG - Intronic
1148519226 17:48253749-48253771 ATGCTCTGGCTGCCACCAAGGGG + Intronic
1148601177 17:48895378-48895400 CAGCTGAGGCTTCCCCAAACGGG - Intronic
1148745398 17:49915276-49915298 CTGCTCACCCTGTCACCAACTGG + Intergenic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1153892828 18:9534108-9534130 CTGCTCAAGCTGACACAGTCAGG - Intronic
1156989340 18:43388424-43388446 CTACTCAGGCCACCAAAAACTGG - Intergenic
1162985448 19:14266437-14266459 ATGCTCAGCCTGCCACAGCCTGG - Intergenic
1163360098 19:16840502-16840524 CAGCTCAGGCTGCCACAACGAGG - Intronic
1163421896 19:17218298-17218320 ATGCTCAGGATGCCGGAAACGGG + Intronic
1164724095 19:30453599-30453621 CGGCTCAGCTTGCAACAAACAGG + Intronic
1166377798 19:42337315-42337337 CTCCTAAGGCTGGCACCAACTGG - Intronic
925669657 2:6297465-6297487 CTGCACAGGCTGCCAGGCACAGG + Intergenic
926441661 2:12895455-12895477 CAGCTCAGGCTGGCAAATACAGG + Intergenic
927125799 2:20011965-20011987 GTCCTCAGGCTGCCTCAGACTGG - Intronic
931088998 2:58865552-58865574 CTGTTAAGACTGCCCCAAACAGG + Intergenic
932810657 2:74823014-74823036 CTGCTGGAGCTGCCAGAAACAGG + Intergenic
935329081 2:101963151-101963173 CTGCTCAGAGTCCCACAAAGGGG - Intergenic
938845337 2:135202831-135202853 CTGCACAGTCTGTCACAAAGAGG - Exonic
942236682 2:173915614-173915636 CTGCTCAGGGTGGGAAAAACAGG + Intronic
944910307 2:204304538-204304560 CTGCACAGGCTGCAACAGAGCGG + Intergenic
945969222 2:216220035-216220057 CTGCCCAGCCTGCCACCACCGGG + Intergenic
949061268 2:241959153-241959175 CTGCTCAGGATGGCACAATCTGG + Intergenic
1170393028 20:15895637-15895659 CTGCCCAGGCTGCCGCCACCAGG - Intronic
1175660607 20:60808938-60808960 CTGCCCAGGCCCCCACAAAAGGG - Intergenic
1175965412 20:62657780-62657802 CTGCTCCGGCAGCCACATAGGGG + Intronic
1176422267 21:6525729-6525751 CTCCCCAGGCCTCCACAAACAGG + Intergenic
1177407364 21:20687220-20687242 TAGCTCAGACTGCCATAAACTGG - Intergenic
1179697758 21:43134045-43134067 CTCCCCAGGCCTCCACAAACAGG + Intergenic
1179721807 21:43320585-43320607 CATCTCAGGCTGCCAGAAGCTGG + Intergenic
1180086971 21:45512051-45512073 CTGCAGAGGCTCCCACAACCTGG - Intronic
1181329171 22:22075666-22075688 CTTCTCATGCTGACACACACAGG + Intergenic
950136280 3:10583448-10583470 CTGCTCAGGCTAGGACAAACAGG - Intronic
950868503 3:16208993-16209015 CATCTCAGGTTGCCACACACTGG - Intronic
955364072 3:58297053-58297075 CGGCTGAAGCTGCCACACACTGG - Intergenic
955616251 3:60810111-60810133 GTGTTGAGGCTGACACAAACTGG - Intronic
959947138 3:112137106-112137128 CTGCTCAGGCTGCCCCAACTAGG - Intergenic
961492449 3:127265050-127265072 CTGCTCAGGCTGCACCCAAGGGG - Intergenic
961524841 3:127490225-127490247 CTGCTCAGGCTGCCATAGACTGG - Intergenic
962280668 3:134049465-134049487 CTGCTCAGCCTGCTGCAAACTGG + Intronic
964824273 3:160808480-160808502 CTCCTCAGGCTGCCACTATCAGG - Intronic
967498515 3:190169603-190169625 CTGCTGATGCTGCCACATAATGG + Intergenic
968914884 4:3493100-3493122 CTGCTCAGCCTGCCAGCAGCGGG + Exonic
969181642 4:5446515-5446537 CTGCCCAGGCTGGCACATAATGG - Intronic
970589620 4:17547893-17547915 GTGCTAGGGCTGCCACAGACTGG - Intergenic
971309747 4:25515094-25515116 CTGCTCAGGATGGCACAGGCTGG - Intergenic
972411275 4:38797360-38797382 CTGCTAAAGCTGCCACATCCAGG + Exonic
972414805 4:38827987-38828009 CTGCTAAAGCTGCCACATCCAGG + Exonic
974190489 4:58496590-58496612 CAGCTCAGGCTGGAACAAGCAGG + Intergenic
977435043 4:96984055-96984077 CTGCTCACACAGCCACAAAGTGG - Intergenic
979252726 4:118582221-118582243 CAACTCAGGCTGCCATAGACTGG + Intergenic
980881857 4:138718619-138718641 CTCCCCAGGCATCCACAAACAGG - Intergenic
985971141 5:3379503-3379525 TTGCTCGGGCTGCCCCAACCAGG + Intergenic
986614511 5:9602569-9602591 CTGCTCAGGCTGCCACTATAAGG - Intergenic
986727213 5:10607912-10607934 ATGCTCAGGCTGCCAGGAATAGG - Intronic
987291524 5:16512868-16512890 CTGCTCCAGGTGCCAGAAACGGG + Intronic
987593106 5:19958656-19958678 CTTCCCAGGCTGACACTAACAGG - Intronic
991447438 5:66715202-66715224 CTCCTCAGGGTGCCAGAAAAAGG + Intronic
995691299 5:114829351-114829373 CTGCACAGGCTACTACACACTGG + Intergenic
1000364950 5:160481892-160481914 CTCCCCAGGCCTCCACAAACAGG - Intergenic
1002163938 5:177333052-177333074 CTGCACAAGCTGCCACCAGCAGG + Intronic
1003138090 6:3448437-3448459 GTCCTGAGGTTGCCACAAACTGG - Intronic
1006283911 6:33078586-33078608 TTGCTAAGGGTTCCACAAACAGG + Intronic
1007115941 6:39343369-39343391 CTGCTCAGGCTTCTACAAACAGG - Intronic
1007344897 6:41222261-41222283 CTCCTCATGCTTCCACAAAGGGG - Intergenic
1007475728 6:42118639-42118661 CTGCCCAGGCTGGCCCAAAGAGG - Intronic
1011621955 6:89251445-89251467 CTTGTCAGGATGCCACAGACGGG + Intergenic
1012896671 6:104957065-104957087 GTGCTCAGGGGGCCAGAAACTGG + Exonic
1017602435 6:156098261-156098283 CTTCTCAGGCTGCCATAACAAGG - Intergenic
1018371160 6:163169794-163169816 TTGCCCAGCCAGCCACAAACTGG + Intronic
1018568893 6:165186419-165186441 CTCTCCAGGCTGCCACACACTGG + Intergenic
1019740031 7:2668167-2668189 ATGCTCAAGGTGCCCCAAACTGG - Intergenic
1020910975 7:14131026-14131048 CTACACCGGCAGCCACAAACTGG - Intergenic
1023780562 7:43651494-43651516 CTGCTCAAGCTGGCACAGGCTGG + Intronic
1024256845 7:47545805-47545827 CTGCTCAGGCTGCCCCCAGGTGG - Intronic
1026333248 7:69371729-69371751 CTGCTCAAGCTCACATAAACAGG + Intergenic
1028236140 7:88363852-88363874 CTCCCCAGGCTTCCACAAACAGG - Intergenic
1031867294 7:127051467-127051489 CTGCTCAGGCCAACACAAATAGG - Intronic
1033347984 7:140540321-140540343 CAGCTGTGGCTGCCACAAGCAGG - Intronic
1034559381 7:151870482-151870504 TTGCTCAGGATGGTACAAACTGG + Intronic
1037721802 8:21450629-21450651 CTTCTCTGGCTCCCAGAAACTGG + Intergenic
1039231794 8:35456471-35456493 CTGCTCAGGCATCCACAAAAAGG - Intronic
1039867386 8:41517432-41517454 CTGAGCAGGCTGCAACAACCTGG + Intergenic
1042775041 8:72420621-72420643 CTGATCATGCTGCCAAAAATAGG + Intergenic
1044365070 8:91335866-91335888 CTCCCCACGCTGCCACATACTGG - Intronic
1045819359 8:106317681-106317703 ATCCTCAAGCTGCCAGAAACAGG - Intronic
1048005564 8:130416725-130416747 CTGCTTAGGCTGCCACCTAATGG + Intronic
1052803113 9:32988471-32988493 CTGCCCAGGCTGGGAGAAACAGG - Intronic
1057185968 9:93057956-93057978 CTGCCCAGGCAGCCACCAAAGGG - Intergenic
1060194223 9:121612834-121612856 CTGCTCAGGTTTCTGCAAACAGG + Intronic
1062226909 9:135457513-135457535 CAGCCCAGGTTGCCTCAAACAGG - Intergenic
1062283576 9:135763013-135763035 CTGCTCTGCCTGCCCCACACGGG - Intronic
1188447074 X:30265697-30265719 CTACTCAAGTTGCCACTAACAGG - Intergenic
1188743904 X:33817874-33817896 CTGCATGGGCTGCCACACACTGG - Intergenic
1192546518 X:72018801-72018823 CTGCTCTGGCTGCCAAAGGCCGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195711012 X:107774018-107774040 TTGCTCAGGCTCATACAAACAGG + Intronic