ID: 1080311885

View in Genome Browser
Species Human (GRCh38)
Location 11:30904172-30904194
Sequence TTCACCCAGGGATCCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080311885 Original CRISPR TTCACCCAGGGATCCACAGC TGG (reversed) Intronic