ID: 1080311993

View in Genome Browser
Species Human (GRCh38)
Location 11:30905451-30905473
Sequence TGCCATGGCCAGAGAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080311993 Original CRISPR TGCCATGGCCAGAGAGAGCC TGG Intronic
900178521 1:1301493-1301515 GGCCAAGGCCAGAGAATGCCAGG - Intronic
900266974 1:1762304-1762326 TGCCAGGGCCAGGGCCAGCCTGG + Intronic
900418066 1:2544064-2544086 TGCCAGGGCCAGAGCGTGCAGGG - Intergenic
900951817 1:5862333-5862355 TGCCAGGGGCAGAGAGAGAGTGG - Intergenic
900985976 1:6072957-6072979 TGCCATGGCAACAAAGAGGCAGG + Intronic
901209887 1:7518797-7518819 TCCCATGGGCAGAGGGAGCCTGG + Intronic
901646581 1:10720065-10720087 TGGCCTGGCCACAGAGAGCTTGG + Intronic
902696403 1:18143600-18143622 TCCCATGGCCTGGCAGAGCCTGG + Intronic
903369207 1:22824480-22824502 TGGCACCGCCAGAGAGACCCTGG - Intronic
903830196 1:26169967-26169989 ACCCATGGCCAGAAACAGCCCGG - Exonic
904472111 1:30742384-30742406 GGCCCTGGCCAGGGATAGCCAGG - Intronic
904896565 1:33822430-33822452 TTCCATGGCCAGCCATAGCCTGG - Intronic
910667229 1:89738891-89738913 TGCCCTGACCAGGCAGAGCCTGG - Intronic
911047317 1:93639290-93639312 TGTCATGGCAGGAGAGAGCTGGG - Intronic
911051837 1:93677981-93678003 AGCCATGGTAAGAGAGAGCAGGG - Intronic
914929781 1:151920837-151920859 TGGCATGCCCAGAGAGGGCATGG - Intergenic
915276614 1:154793245-154793267 TGCTGTGGGCAGAGAGAACCAGG - Intronic
917517765 1:175722153-175722175 CTCCATGGCCAGGGAGGGCCCGG - Intronic
918014497 1:180619926-180619948 TCCCATGGCCACAGAGAATCTGG - Intergenic
918046085 1:180941805-180941827 TGGCATGGCCAGAGAGTTTCTGG + Intronic
919792181 1:201299152-201299174 GGCCATGCCCAGAGACAGCCCGG + Intronic
919921245 1:202167841-202167863 TGCCAAGGCTGGAGAGAGCGGGG + Intergenic
920507652 1:206527749-206527771 GCCCAAGGCCAGAAAGAGCCTGG - Intronic
920564915 1:206965646-206965668 TGACTTGGTCTGAGAGAGCCTGG + Intronic
922336101 1:224619086-224619108 TGCCTTGGCCAGAGGGTGTCAGG + Intronic
922698956 1:227746843-227746865 TGCCAGGGCCAGAGCCAGGCCGG - Intronic
923958772 1:239053515-239053537 TGGCTTGGGCAGAGACAGCCTGG - Intergenic
1062971795 10:1654113-1654135 TGCAATGGCCACAGAGAACAGGG - Intronic
1063123899 10:3123820-3123842 TGCCATGGCCAGAGCCTGCCAGG + Intronic
1064300100 10:14115702-14115724 TCACATGGCAAGAGAGAGCGGGG - Intronic
1065008821 10:21403598-21403620 TCCCATGGCCACAGAGAACAAGG + Intergenic
1065185421 10:23166001-23166023 GGGAATGGCCAAAGAGAGCCAGG + Intergenic
1065323842 10:24533279-24533301 TGCCATGGCTGGAGAGACCCAGG - Intronic
1065489661 10:26270085-26270107 AGCCATGGCCAGAGAGACTGAGG + Intronic
1066228104 10:33404357-33404379 TGCAATGGAAAGAGAGAGTCAGG - Intergenic
1066420421 10:35260008-35260030 TACCAGGGCCAGAGAAAGCACGG + Intronic
1066961774 10:42232505-42232527 GGCCAGGGCCAGGGAGGGCCAGG + Intergenic
1067242583 10:44508980-44509002 TGACAAGGCCAGAGAGCCCCAGG - Intergenic
1067804090 10:49381398-49381420 TGCTCGGGCCAGAGGGAGCCGGG - Intronic
1068505743 10:57897467-57897489 AGCCATGGCCACATAGAGCTTGG + Intergenic
1068834927 10:61543107-61543129 TGGCATGCCCAGGGAGAGCATGG - Intergenic
1069594367 10:69661111-69661133 TGGCAGGGGCAGAGAGAGTCGGG + Intergenic
1069870565 10:71530310-71530332 TGAGCTGGCCAGACAGAGCCGGG - Intronic
1070930759 10:80259019-80259041 GGCCATGGGCAGACAGAGCCAGG - Intergenic
1070961943 10:80505468-80505490 AGGCCTGGCCAGAAAGAGCCAGG + Intronic
1071351480 10:84750407-84750429 TGGCATGGCCAGAGACCTCCTGG - Intergenic
1071829867 10:89360943-89360965 TGCCATGTGAAGAGAGAGCATGG - Intronic
1073947921 10:108773544-108773566 TGGCATAGCCAGAGAGAGCATGG - Intergenic
1074603396 10:114937002-114937024 TGCCATGGAAGCAGAGAGCCAGG - Intergenic
1075270063 10:121041861-121041883 TGCAATGGCCAGACAGCCCCTGG - Intergenic
1075957820 10:126539062-126539084 GGCCATGGGGAGAAAGAGCCTGG + Intronic
1076478242 10:130767332-130767354 TGCCATGCTCAGAAGGAGCCCGG + Intergenic
1076736492 10:132461427-132461449 TGCACAGGCCAGAGAGTGCCAGG - Intergenic
1077058127 11:605806-605828 ACCCAGGGCCACAGAGAGCCAGG - Intronic
1077338677 11:2016551-2016573 CGCCATGGCCAGAGGGCCCCAGG + Intergenic
1078621718 11:12914691-12914713 TGCCATGGGCAGAGAGAAGGGGG - Intronic
1079469907 11:20768411-20768433 TGCCATGGCCTGAAAGGCCCTGG - Intronic
1080311993 11:30905451-30905473 TGCCATGGCCAGAGAGAGCCTGG + Intronic
1080497475 11:32833996-32834018 TACAAAGGCCAGAGAGAACCAGG + Intronic
1080813276 11:35727361-35727383 TGCCTTGGCTTGAGAGAGCCTGG + Intronic
1080894030 11:36434163-36434185 TGGCATGGCCTGAGAGCACCAGG + Intronic
1081575609 11:44317018-44317040 TGCCCTTGCCAGAGAGGGCGGGG - Intergenic
1083236302 11:61353026-61353048 TGCGATGGACAGAGAGAGGATGG + Exonic
1083699687 11:64467736-64467758 TGGTATGGCCAGAGAGGGCATGG + Intergenic
1084435559 11:69137274-69137296 TGACATGTCCAGGGAGAGCTGGG + Intergenic
1085531353 11:77194114-77194136 TGCCAGTGCCAGAGGGATCCAGG + Intronic
1089555677 11:119314976-119314998 GGCCAGGGCCAGAGCGAACCTGG - Exonic
1089847508 11:121470075-121470097 GGCCTTGGCCCGAGATAGCCTGG + Exonic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1202821661 11_KI270721v1_random:71733-71755 CGCCATGGCCAGAGGGCCCCAGG + Intergenic
1093981116 12:25476945-25476967 TGCCATGGCCAGGGTAATCCAGG + Intronic
1094058368 12:26288311-26288333 TGCCAAGGCCAGACAAGGCCAGG + Intronic
1094618623 12:32059061-32059083 TGCCATGGCCAGAGTCAGATTGG - Intergenic
1096182618 12:49559026-49559048 GGGAAAGGCCAGAGAGAGCCAGG + Intronic
1096653539 12:53074449-53074471 TCCCATGGCCAGAGGAAGCTGGG - Intronic
1097183740 12:57185324-57185346 TCCGATGGCCCGAGAGACCCAGG + Intronic
1097932659 12:65206619-65206641 TGCCATGGCCTGAGAGAGAAGGG + Intronic
1099103433 12:78471639-78471661 TGGCATGCCCAGAGAGGGCATGG + Intergenic
1099573038 12:84348975-84348997 TGCCAGGCCAAGAGAGAGCAGGG - Intergenic
1099801406 12:87461431-87461453 TGCCAGGCCCAGAGAGAGCAAGG + Intergenic
1102214610 12:111151775-111151797 TGTGATGGCCGGAGCGAGCCTGG - Intronic
1102595310 12:113987752-113987774 TCCCAGGGGCAGAGAGAGCCTGG - Intergenic
1103083893 12:118046615-118046637 TGCCAGGGCCAGAGCCAGGCAGG - Intronic
1103162399 12:118740327-118740349 TGTCAAGAGCAGAGAGAGCCTGG + Intergenic
1103618953 12:122174167-122174189 GGCCATGGCGAGAGAGAGCAAGG + Exonic
1106250098 13:27976552-27976574 TACCCTGGCTAGAGAGAGGCAGG + Intergenic
1109332016 13:60942007-60942029 TGGCATGCCCAGAGAGGGCATGG - Intergenic
1112162535 13:96883972-96883994 TGTGATGGCCAAAGAGAACCTGG - Intergenic
1113672044 13:112182242-112182264 GGCAAGGGCCAGAGACAGCCAGG + Intergenic
1113852102 13:113423690-113423712 CTCCATGGCCAGAGACGGCCAGG + Intronic
1114590905 14:23863929-23863951 TGCAATGGCCAGTGATAGCCAGG - Intergenic
1115566100 14:34627056-34627078 AGCTATGGCTTGAGAGAGCCAGG - Intronic
1115651079 14:35403649-35403671 TCCCAGGGTCAGAGAGAACCCGG + Intronic
1117976204 14:61299258-61299280 TGCAATGGCCAGCCAGTGCCTGG + Intronic
1117982565 14:61356489-61356511 TGTCAAAGCCAGAGATAGCCCGG - Intronic
1118333580 14:64833136-64833158 GAACATGTCCAGAGAGAGCCGGG - Intronic
1118556225 14:67025750-67025772 TGCTATAGCCAGTGAGACCCAGG - Intronic
1118681507 14:68246214-68246236 TCCCATGGCCAAACAGAGCCAGG - Intronic
1119007199 14:70942666-70942688 TGGCATGCCCAGAGACAGCATGG - Intronic
1122225991 14:100279878-100279900 TGCCATGGCCTGCAGGAGCCAGG + Exonic
1122890099 14:104728238-104728260 TGCCTTGGCCAGGGAATGCCTGG + Intronic
1202858367 14_GL000225v1_random:64974-64996 GGACATGGGCAGAGAGAGGCCGG + Intergenic
1202921807 14_KI270723v1_random:34615-34637 GGACATGGGCAGAGAGAGGCCGG - Intergenic
1202923109 14_KI270724v1_random:2966-2988 GGACATGGGCAGAGAGAGGCCGG + Intergenic
1124567126 15:30826591-30826613 TGCCCAGGCCAGACAGAGACAGG - Intergenic
1126947271 15:53835604-53835626 TGCCAGGAACAGAGAGAGACTGG + Intergenic
1127089948 15:55457216-55457238 TGGCATGGCCAGAGTGAGACTGG + Intronic
1127389305 15:58492271-58492293 TTCCATGGCCATAGAGAGCATGG - Intronic
1128214143 15:65922731-65922753 AGCCATGGCCTGAGAGAGGCTGG - Intronic
1128580917 15:68809071-68809093 GGACATGGGCAGAGAGAACCCGG + Intronic
1129331598 15:74830612-74830634 GGCCATGGCCAGAGAGGGATGGG - Exonic
1129361548 15:75027740-75027762 TGCCGTGGGCAGCGAGGGCCAGG - Intronic
1129740867 15:77988960-77988982 TGCAGGGGCCACAGAGAGCCTGG - Intronic
1129844857 15:78763580-78763602 TGACAGGGCCACAAAGAGCCTGG + Intronic
1129997853 15:80022482-80022504 TGCCAGGGCCAGTAACAGCCTGG + Intergenic
1130136740 15:81187906-81187928 TCCCAAGCCCAGAGATAGCCAGG - Intronic
1130907048 15:88248048-88248070 GCTCATGGCCAGCGAGAGCCTGG - Intronic
1131390398 15:92043445-92043467 TGCCTGGGCCAGTGAGAGGCTGG - Intronic
1131473222 15:92714286-92714308 TGCCAGGGCCGGGGAGAGCGGGG + Intronic
1132954825 16:2585991-2586013 TGCCAAGGCCAGAGAGTCCCTGG - Intronic
1133101572 16:3483184-3483206 TCTCATGGCCAGATGGAGCCTGG - Intronic
1133838971 16:9391788-9391810 TTCCGTTGCCATAGAGAGCCAGG + Intergenic
1133925295 16:10187364-10187386 TTCCATGTCCAGAGGAAGCCAGG + Intergenic
1133929137 16:10218016-10218038 TGGCATGGCCAGACACAGCCAGG + Intergenic
1136461596 16:30414419-30414441 TCACATGGCCAGTGGGAGCCAGG - Intronic
1137244258 16:46689617-46689639 TGCACCGGCCAGTGAGAGCCAGG - Intergenic
1138497582 16:57417528-57417550 AGCAAAGGCCAGAGACAGCCGGG + Intergenic
1138770959 16:59663243-59663265 TGCTCAGGACAGAGAGAGCCCGG + Intergenic
1139026298 16:62822544-62822566 TCACATGGCAAGAGAGAGACTGG - Intergenic
1139337885 16:66245751-66245773 TGCCATGGCCAGAGGTTCCCGGG + Intergenic
1139504297 16:67391433-67391455 TGCCAGGGCCAGACAAAGCCAGG - Exonic
1139698372 16:68691778-68691800 TGCCATGGTCAGACAGAGAAAGG - Exonic
1140164816 16:72540260-72540282 TGGCATGCCCAGAGAGTGCATGG + Intergenic
1140700318 16:77575303-77575325 GGCCAGGGCCAGAGAGGGGCAGG + Intergenic
1140810529 16:78572814-78572836 TGCCATGGCGAGAGATACACAGG + Intronic
1140892620 16:79298181-79298203 CCCCATGGGCAGAGAGAGGCTGG - Intergenic
1141194158 16:81847252-81847274 TGGCATGCCCAGAGAGAACATGG - Intronic
1141267286 16:82508636-82508658 AGCCATGGCAAGACAGAGGCAGG + Intergenic
1141426936 16:83950124-83950146 GGCCATGTGCACAGAGAGCCTGG - Intronic
1141600972 16:85126218-85126240 TGCCATGCCCAGGGAGTCCCGGG + Intergenic
1142110097 16:88326770-88326792 TGCCCTGGCCAGGGAAGGCCTGG - Intergenic
1142597660 17:1037353-1037375 TGACGTGGCCAGAGAGAGGCTGG - Intronic
1142748451 17:1972867-1972889 GGACCAGGCCAGAGAGAGCCTGG + Intronic
1143184750 17:5003498-5003520 GGCAAGGGCTAGAGAGAGCCAGG - Intronic
1143363155 17:6387755-6387777 GGCCACAGCCAGAGGGAGCCTGG + Intergenic
1143386143 17:6531769-6531791 TGGTGTGGCCAGAGTGAGCCAGG - Intronic
1143506490 17:7368609-7368631 TGTCATGCCCAGAGAGGGCACGG + Intergenic
1143793412 17:9316564-9316586 TGGCATGCCCAGAGAGTGCATGG + Intronic
1143938962 17:10518421-10518443 TGCCAGGGACAGTGGGAGCCAGG + Intronic
1144850493 17:18241703-18241725 CGCCATGGCCAGGGTGAGGCGGG + Exonic
1145239058 17:21228980-21229002 GCCCAGGGCCAGAGAGAGCAGGG + Intergenic
1145974374 17:28975905-28975927 TGCCAAGTGCAGAGAGAGGCAGG + Intronic
1147202821 17:38814883-38814905 TGACATGGCCAGCAAGATCCGGG - Exonic
1147573477 17:41585734-41585756 TGCCCTGCACAGAGAGAGCCTGG - Intronic
1147858285 17:43499997-43500019 TGCCTTGGCCAAAGAAAGGCGGG + Exonic
1148050406 17:44767458-44767480 TGCCAGGGCCACAGAGATTCTGG + Intronic
1148178435 17:45586443-45586465 TGCCATGGCCAAAAAGGCCCTGG + Intergenic
1148212779 17:45818259-45818281 GGCCATGACCACAGACAGCCTGG - Intronic
1148270725 17:46260012-46260034 TGCCATGGCCAAAAAGGCCCTGG - Intergenic
1148468151 17:47877307-47877329 TGCCATGCCCTGAGAGGGGCTGG + Intergenic
1148593379 17:48833190-48833212 TGCCATAGCCAGGGAGAAACGGG + Intronic
1149341545 17:55691830-55691852 TGCCCTGGCCAGGGCAAGCCAGG + Intergenic
1150557497 17:66267736-66267758 TGACATGGCCATAGACAGCTGGG - Intergenic
1150740006 17:67771862-67771884 TGCCCCGGCCAGAAAGAGCAGGG + Intergenic
1151318166 17:73336661-73336683 TGCCAAGGTAAGAGAGAGCCTGG - Exonic
1151469980 17:74311974-74311996 ACCCAGGGACAGAGAGAGCCCGG - Intronic
1153225145 18:2894197-2894219 TGGCTTGGTCAGGGAGAGCCAGG + Intronic
1155035413 18:22021248-22021270 TGCCTTAACCAGACAGAGCCGGG - Intergenic
1156467329 18:37356041-37356063 TACCATTTCCAGAGAGACCCTGG - Intronic
1157318032 18:46609872-46609894 GGGCAAGGCCAGATAGAGCCAGG + Intronic
1157726565 18:49968882-49968904 TGGCATGGACAGAGAGAACATGG + Intronic
1158634821 18:59147551-59147573 TGGCACAGCCAGAGAAAGCCAGG + Intronic
1159784993 18:72703057-72703079 TCACATGGCAAGAGAGAGCAAGG + Intergenic
1160916968 19:1501411-1501433 TGCCAGGTGCAGAGCGAGCCTGG - Intergenic
1162533083 19:11247044-11247066 TGCGATGACCACACAGAGCCGGG - Intronic
1163689503 19:18730878-18730900 TCCCATGTCCAGAGGGAGCTTGG + Intronic
1163730542 19:18946887-18946909 TGCCTGGGCCTGAGGGAGCCTGG - Intergenic
1164642806 19:29838879-29838901 GGGCATTGCCAGGGAGAGCCAGG - Intergenic
1166316412 19:41992207-41992229 GGCCAGGGCCAGGGTGAGCCAGG - Intronic
1166634551 19:44438791-44438813 TGACATGCCCAGAGAGGGCATGG + Intronic
1167449122 19:49556738-49556760 TGCAAGGGGCAGAGAGAGGCGGG + Intronic
926040360 2:9667823-9667845 TCCCATGGGTAGAGAGTGCCTGG + Intergenic
926800510 2:16656074-16656096 AGCCTTGTCCAGAGAGTGCCTGG + Intronic
927312627 2:21648214-21648236 TGCAATGTCCACTGAGAGCCAGG + Intergenic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
927593164 2:24374182-24374204 TGGCATGTCCAGAGAGGGCATGG + Intergenic
928201789 2:29251873-29251895 AGCCATGGCCAGGGAGTGCAGGG - Intronic
928239265 2:29572464-29572486 CGCCATGGCACAAGAGAGCCAGG - Intronic
929446779 2:42008423-42008445 TGCTATGGCAAGAAAGTGCCAGG + Intergenic
929925097 2:46201246-46201268 TTCCTTGGCCTGGGAGAGCCAGG - Intergenic
930680217 2:54249690-54249712 TGCCATGGCCTCAGAGTGCTGGG - Intronic
930933754 2:56920682-56920704 TGGCATGCCCAGAGAGGGCATGG + Intergenic
931564564 2:63601925-63601947 TGCCATGACCAGAAAGAACTGGG - Intronic
932044974 2:68339345-68339367 TGCCATGCCCAGAGAGGGTCTGG + Intergenic
932632261 2:73355104-73355126 TGGCATGGCCAGGAAGGGCCTGG - Intergenic
935064456 2:99635940-99635962 TGCCTTTGCCAGAGAGGGGCAGG + Intronic
936062200 2:109302425-109302447 TGCCATGGAGGCAGAGAGCCAGG + Intronic
937115429 2:119401664-119401686 TGGCGTGTCCAGAGAGAGCATGG - Intergenic
938159602 2:128973463-128973485 TGACATGGCCACAGAGGCCCTGG - Intergenic
941721521 2:168817683-168817705 TCCCTGGGCCAGAGTGAGCCGGG + Intronic
943351292 2:186799344-186799366 TGCCAACGCCAGTGAGAACCCGG + Intergenic
944936558 2:204575652-204575674 CCCCACAGCCAGAGAGAGCCAGG - Intronic
945185941 2:207139748-207139770 TGCAATGACCAGAGAGAACTCGG - Intronic
945657621 2:212644422-212644444 AGCCCTGCCCAGGGAGAGCCTGG - Intergenic
946039821 2:216773936-216773958 AGCCATGGCCAGATATGGCCTGG + Intergenic
946185679 2:217979105-217979127 TGCCAGGGGCAGAGGTAGCCCGG + Intronic
947400901 2:229730764-229730786 TGTCAAAGCCAGGGAGAGCCTGG - Intergenic
947443731 2:230146784-230146806 TGCCAGGGCTGGAGAGAGCAGGG + Intergenic
948803023 2:240441384-240441406 TGCCCGGGCCAGTGAGAGGCTGG + Intronic
1168806951 20:677041-677063 TTCCATTGACAGCGAGAGCCTGG - Intergenic
1170874845 20:20240772-20240794 TGACATGGCCAGGGAGAAGCAGG - Intronic
1171401129 20:24873556-24873578 TGCCATGACCAGACAGGGGCAGG - Intergenic
1172753844 20:37269832-37269854 GGCCATGGCCTCAGACAGCCGGG + Intergenic
1174772111 20:53310024-53310046 TTCCATGGTCAGAGAGAGTTGGG - Intronic
1175226283 20:57445745-57445767 TGCCAGGGCAGGAGAGAGCCAGG + Intergenic
1176255383 20:64149381-64149403 TGCAAAGGCCCGAGGGAGCCGGG + Intergenic
1178683773 21:34695547-34695569 GGCCATGGCCAGAGAGAGTGTGG + Intronic
1179047146 21:37856100-37856122 AGCCATGGCCAGAGACAGGAGGG + Intronic
1181625743 22:24121057-24121079 GGCGAGGGCCAGAGAGGGCCAGG + Intronic
1182441749 22:30368680-30368702 GGCCTTGGGCAGAGAGGGCCTGG - Intronic
1183512404 22:38243822-38243844 AGCCATGCCCAGACAGAGCCGGG - Intronic
1184145789 22:42609507-42609529 TGCCCTCCCCAGACAGAGCCAGG - Intronic
1184762301 22:46551481-46551503 TGCCAACGCCAGCGGGAGCCAGG - Intergenic
1184837860 22:47034619-47034641 AGCCAGGCCCAGAGACAGCCGGG - Intronic
1184881190 22:47305045-47305067 GGCCCTGGCCACACAGAGCCTGG - Intergenic
1185159032 22:49211745-49211767 TGTCCTGGCCAGATGGAGCCCGG - Intergenic
949556471 3:5157667-5157689 TGCAATGGCAAGAGAGAGGGTGG + Intronic
949606340 3:5658406-5658428 TCCAATGTCCAGAGAGAGACTGG - Intergenic
952312011 3:32198934-32198956 AGCCATCCCCAAAGAGAGCCAGG - Intergenic
953033783 3:39193983-39194005 TGCCCTTCCTAGAGAGAGCCAGG - Intergenic
956210119 3:66793784-66793806 TGCGTTAGCCAGAAAGAGCCAGG - Intergenic
956292007 3:67670390-67670412 TGCCATGCATATAGAGAGCCAGG - Intergenic
957157538 3:76564616-76564638 TGTCATGGCCTCACAGAGCCTGG - Intronic
961015404 3:123464621-123464643 TGCAAGGGCCAGAGGGAACCGGG + Intergenic
961450643 3:127000896-127000918 TGGCATGGCCAGTGTGAGCGGGG - Intronic
961552024 3:127674849-127674871 TGCAATGGCAAGAGAGAGGCAGG - Intronic
961621299 3:128227004-128227026 TGCAATGGCCCGAGAGGGGCCGG - Intronic
962469156 3:135689743-135689765 GAACATAGCCAGAGAGAGCCAGG - Intergenic
963389250 3:144636882-144636904 TGACATGGCAAGACAGAGCAAGG - Intergenic
963726044 3:148922892-148922914 TGGCATGACCAGAGAGGGCATGG + Intergenic
965545110 3:169908088-169908110 TGCCAAGGCCAGGCAGAGACAGG + Intergenic
967732410 3:192918118-192918140 TGCCGCTGCCAGAGAGGGCCAGG - Exonic
967878987 3:194285869-194285891 TGCCCTGGCCAGGGAGCACCAGG - Intergenic
969435252 4:7185720-7185742 TGCCATGGGAACAGAGAGCGGGG - Intergenic
971023630 4:22565871-22565893 TGGCATGCCCAGAGAGGGCATGG + Intergenic
973704866 4:53571444-53571466 AGCAGAGGCCAGAGAGAGCCTGG + Intronic
974979955 4:68943338-68943360 TGCCATGGCTTAAGAGAGCTTGG + Intronic
977269202 4:94894262-94894284 TGCCAAGGTCACAGAGACCCAGG - Intronic
977677502 4:99764046-99764068 TGCAATGGCCTGAGTCAGCCAGG - Intergenic
977730806 4:100349475-100349497 TGGCATGGCCAGAGACAGCAGGG + Intergenic
979302179 4:119099548-119099570 TGTACTGGCAAGAGAGAGCCTGG - Intergenic
979524749 4:121705286-121705308 TGCCATGCCTGGAGAGGGCCTGG - Intergenic
979610835 4:122687209-122687231 TGGCATGCCCAGAGAGAGCCTGG + Intergenic
979692570 4:123575531-123575553 TGCTATTGCAAGAGACAGCCTGG + Intergenic
982206544 4:153001197-153001219 TGCCATGGCCAGGGAGTACTGGG + Intergenic
982480870 4:155908344-155908366 AGCCATGGCAAGAGAAAGCAGGG - Intronic
983328803 4:166296699-166296721 TGCCATGGCAGGACAGAGACTGG + Intergenic
985363319 4:189198879-189198901 AGCGATGGCCAGAAAGAGCAAGG - Intergenic
986771062 5:10974106-10974128 TGCCATGGGCTGAGAGAGAGGGG - Intronic
989209769 5:38846869-38846891 AGCCCTGGCCTGCGAGAGCCGGG - Intronic
990339847 5:54811532-54811554 TTCCATGGCAAGAGAAAGTCCGG - Intergenic
992202504 5:74398279-74398301 AGCCATGGCCACACAGAGCTGGG + Intergenic
992888874 5:81185619-81185641 TGCCACATCTAGAGAGAGCCAGG + Intronic
995277530 5:110294196-110294218 TGCCATAGATAGAGGGAGCCAGG + Intronic
998266701 5:140672451-140672473 TGCCATGGCCAAAAAGGCCCTGG - Exonic
998899309 5:146835661-146835683 TGCCTGGGCCAGACAGACCCAGG + Intronic
1001293946 5:170485704-170485726 TGCCAGGCCCAGAGGCAGCCTGG - Intronic
1001667063 5:173442007-173442029 TGCCATGGCCTCAGGGAGCATGG - Intergenic
1001882642 5:175257982-175258004 AGCTATGGCCAGAGAGAGCCAGG + Intergenic
1002078521 5:176723938-176723960 AGCCAGGGCCACAGAGAGTCAGG + Intergenic
1002876650 6:1216350-1216372 GGCCAGGGCCAGAGTGAGGCAGG - Intergenic
1002899630 6:1400067-1400089 AGACATGGCCAGGGAGGGCCAGG + Intergenic
1002998572 6:2309868-2309890 CTCCATGACCATAGAGAGCCAGG - Intergenic
1003964870 6:11243157-11243179 TGCCATGACCAGAGAGTGGGTGG + Intronic
1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG + Intergenic
1006028694 6:31163534-31163556 TGTCAGGGCAAGAGAAAGCCTGG + Exonic
1006408162 6:33857035-33857057 TGCCAAGACCAGAGAGGGCAAGG + Intergenic
1006611965 6:35299445-35299467 TGTGAAGGGCAGAGAGAGCCTGG - Intronic
1007053194 6:38854313-38854335 TGATCTGGCCAGAGAGAGCATGG + Intronic
1007535879 6:42588289-42588311 TGGCATGCCCAGAGAGGGCATGG - Intronic
1007943426 6:45803490-45803512 AGAAATGGCCAGAGAGAGCAGGG - Intergenic
1011026771 6:82877947-82877969 TGCCAAGGCCAGAGACACACGGG - Intergenic
1012217806 6:96609814-96609836 TGCCATGGCCATAGTGAGCTAGG - Intronic
1015690605 6:135917937-135917959 TGCCAGGGCCACAAAGAGCTGGG - Intronic
1016426482 6:143941513-143941535 TGCCATGGGCACTGTGAGCCTGG - Exonic
1016598563 6:145829277-145829299 TGGCAACGCCAGAGAGAGCTGGG - Intergenic
1016949140 6:149563538-149563560 TGCCATGGCAAGATAGATCATGG - Intergenic
1017793094 6:157818895-157818917 TGGCATGGGCAGAGAGAGACTGG - Intronic
1019067977 6:169318476-169318498 TCCCTTGTCCAGAGAGAGGCTGG + Intergenic
1019177067 6:170165382-170165404 AGCCATCCCCAGAGAGAGGCAGG - Intergenic
1019294311 7:265964-265986 TCCCATGGCCCTAGAGGGCCAGG - Intergenic
1019462705 7:1169487-1169509 CGCCATGGCTGGTGAGAGCCAGG - Intergenic
1019506605 7:1394617-1394639 TGCCACAACCTGAGAGAGCCTGG - Intergenic
1019595914 7:1858328-1858350 TGTCATGCCCAGAGTGGGCCAGG - Intronic
1022099382 7:27160334-27160356 TGCCGCGGCCAGAGACAGCCCGG + Intergenic
1022111998 7:27237514-27237536 TGCAATGGTCAGAGAGGGACTGG + Intergenic
1022423609 7:30246727-30246749 TGCCAGGGACAGTGAAAGCCTGG - Intergenic
1022976822 7:35566355-35566377 TGCCATGGGCAAAGAGAACAGGG + Intergenic
1023018160 7:35986155-35986177 TTCCATGGCCACAGATGGCCCGG + Intergenic
1024673744 7:51619931-51619953 AGACAATGCCAGAGAGAGCCAGG - Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1026001079 7:66559020-66559042 TGCCATGCCCTGGGAGATCCTGG + Intergenic
1026972953 7:74479090-74479112 AGCCCAGGCCAGAGACAGCCAGG - Intronic
1027516556 7:79148767-79148789 AGAAAGGGCCAGAGAGAGCCAGG - Intronic
1027532441 7:79353366-79353388 TGCCACAGCCAGAGACAGCAAGG - Intronic
1028101289 7:86823960-86823982 TGCAGTGGGGAGAGAGAGCCTGG + Intronic
1032059014 7:128708039-128708061 TGCCTAGGCCACAGAGATCCTGG - Intergenic
1032073035 7:128821455-128821477 TGCCATGGCAAGAAAGAGGAGGG - Intronic
1032569041 7:132980221-132980243 TCCCTTGGTCAGTGAGAGCCTGG - Intronic
1034148532 7:148894031-148894053 TCCCAAGGCCAGAGTGAGCTGGG + Intergenic
1034528971 7:151683739-151683761 TGCCACAGCCAGAGAGGGACAGG + Intronic
1034827829 7:154282577-154282599 TGCCATGGGCAGGGAGGCCCTGG - Intronic
1034841322 7:154400216-154400238 TGCTGTGGCCAGTGAGAGTCAGG - Intronic
1035213394 7:157345977-157345999 TTCCCTGCCCAGCGAGAGCCTGG - Intronic
1035654054 8:1292265-1292287 TTCCTTGGCCAGAAAGAGCCAGG - Intergenic
1036725561 8:11217775-11217797 TCCCATGGGCAGTAAGAGCCAGG + Intergenic
1037189257 8:16101535-16101557 TGGCATGCCCAGGGAGAGCGTGG - Intergenic
1037913999 8:22761067-22761089 GGCCATGGGCAGAGGGGGCCAGG - Intronic
1038325518 8:26569854-26569876 TGCTATGGCATGAGAGAGCTTGG + Intronic
1038535511 8:28350266-28350288 TGCAATGACCAGAAAGAGCTGGG + Intronic
1038561840 8:28587652-28587674 TGACATGGCCAGGGAGAGTGAGG - Intergenic
1038732139 8:30137138-30137160 TGTGATCACCAGAGAGAGCCAGG + Intronic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1040959189 8:53013019-53013041 TGACATGGCCAGGGTGAGCAAGG + Intergenic
1041196540 8:55407201-55407223 GGCCATGGCCAGAAAGAACTTGG + Intronic
1042164338 8:65930886-65930908 TGCCAAGGCCAGACAGTGGCAGG - Intergenic
1043157373 8:76800494-76800516 TGCCACGGGCAGAGAGAGTGAGG - Intronic
1043587733 8:81788858-81788880 TCACATGGCAAGAGAGAGCAAGG + Intergenic
1043850899 8:85215636-85215658 TGGCATGCCCAGAGAGAGCAGGG + Intronic
1046691895 8:117295180-117295202 TGCCATGGTCAGAAAGGCCCAGG + Intergenic
1047734200 8:127751537-127751559 ATCCATGGCCAGAAAGAGTCTGG + Intergenic
1049255327 8:141610676-141610698 TGCCAGTGCCCGAGTGAGCCTGG + Intergenic
1053268856 9:36736205-36736227 TGCCTTGGCAAAAGAGAGCTGGG + Intergenic
1053280689 9:36818312-36818334 GGCCAAGGCCAGAGAGCGTCAGG - Intergenic
1053387707 9:37707780-37707802 AGCCAAGGCCAGTGGGAGCCTGG - Intronic
1056476888 9:86961347-86961369 TGCCATGGCCAGAGAAAAGGTGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057198974 9:93130389-93130411 TGCTATGGCCAGAGCCAGGCCGG - Intronic
1058681864 9:107447097-107447119 TCACAAGGCCAGAGAAAGCCAGG + Intergenic
1058711575 9:107683699-107683721 TGGCAAGGCCAGAGGGTGCCTGG - Intergenic
1058983592 9:110192174-110192196 ACCCATGGCAAGAGAGAGACAGG + Intronic
1059540969 9:115129892-115129914 TGCCATGGCCAGAGAGGAATGGG + Intergenic
1059699130 9:116758359-116758381 TGCCATGCCAGGAGAGTGCCAGG + Intronic
1061179215 9:129014071-129014093 TGCCATGCCCGGGCAGAGCCGGG + Intronic
1061230236 9:129311767-129311789 AGCCATGCCCAGGGAGGGCCGGG + Intergenic
1061411556 9:130424822-130424844 GGCCCTGGCCAGAGAGAGTGGGG + Exonic
1061620770 9:131809968-131809990 TGGCAGGGCCAGGCAGAGCCAGG + Intergenic
1062205716 9:135335794-135335816 TGCCTTGGTCATAGAGGGCCGGG - Intergenic
1062245143 9:135562304-135562326 CGCCATGGCCATGGAGTGCCAGG - Exonic
1186889667 X:13947837-13947859 AGCCAAGGGCACAGAGAGCCAGG - Intergenic
1187190870 X:17033797-17033819 AGCCATGGGCAGAGAGGGACAGG - Intronic
1187391582 X:18889707-18889729 TGCCATGCCCACTGAGGGCCAGG - Intergenic
1188941325 X:36241376-36241398 TGCCAGGCCAAGAGAGAGCAAGG + Intronic
1189469290 X:41301542-41301564 TGCCAGGCTCAGAGAGAACCTGG - Intergenic
1189831740 X:44981436-44981458 TGACATGCCCAGAGAGGGCATGG - Intronic
1190955595 X:55189884-55189906 TACCATGCCCACAGAGAGCATGG - Intronic
1193527483 X:82611546-82611568 TGATATGGACAGAGATAGCCAGG + Intergenic
1194930328 X:99880423-99880445 TGGCATGACCACAGAGAGCAAGG + Intergenic
1195345710 X:103949106-103949128 TCCTATGGCAAGAGTGAGCCCGG + Intronic
1197398291 X:125955536-125955558 AGCCATGGACAGAGAGAACATGG - Intergenic
1198511739 X:137358913-137358935 CCCCATGGCCAGAAACAGCCTGG - Intergenic
1199075417 X:143520253-143520275 TTCCATGGCCACAAAGAGCAAGG + Intergenic
1199248158 X:145630970-145630992 TGCCATGGCCCTCAAGAGCCGGG + Intergenic
1200044291 X:153392870-153392892 GGGCATGGCCAGAGAGGGGCGGG - Intergenic
1200078722 X:153565110-153565132 TGCCAGGGCGAGAGCGAGTCGGG - Intronic
1200244818 X:154517309-154517331 TCTCATGGGCAGAGGGAGCCCGG - Intergenic
1200817456 Y:7548361-7548383 TGGGATGGCCAGAGAGAGGGAGG + Intergenic
1201073969 Y:10172680-10172702 AGACATGGGCAGAGAGAGGCCGG + Intergenic
1201399062 Y:13583124-13583146 TGACATAGGCAGAGACAGCCAGG + Intergenic