ID: 1080313678

View in Genome Browser
Species Human (GRCh38)
Location 11:30924364-30924386
Sequence GAGGCCCTGAACCTAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080313678_1080313680 -2 Left 1080313678 11:30924364-30924386 CCAGTATTTAGGTTCAGGGCCTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1080313680 11:30924385-30924407 TCAGTTGAGTTCTGACGAAATGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080313678 Original CRISPR GAGGCCCTGAACCTAAATAC TGG (reversed) Intronic
905998400 1:42402082-42402104 GAGGCCGTGAACGTAATTAGGGG - Intronic
909114120 1:71513353-71513375 GAGACCCAGACCCTAAATAATGG - Intronic
912228028 1:107758241-107758263 GAGGATCTGAACCTAATTAGTGG - Intronic
915240524 1:154517862-154517884 GATGCCCTGCACCTAAGTACAGG - Intronic
1077718957 11:4608160-4608182 GAGGCCCAGAACCCAAAGCCCGG + Exonic
1080223632 11:29934979-29935001 GAGACCATGAACCTACCTACTGG + Intergenic
1080313678 11:30924364-30924386 GAGGCCCTGAACCTAAATACTGG - Intronic
1081860541 11:46331216-46331238 GAAGCCCTGAATTTAAATCCTGG + Intergenic
1084857985 11:72001006-72001028 GAGGCCCTAGCCCTAAACACGGG - Intronic
1088112656 11:106279679-106279701 GAGGCACAGTACCTAAAGACAGG - Intergenic
1088895186 11:114073084-114073106 GAAGACCTGAACATAAATCCTGG - Intronic
1090070457 11:123539874-123539896 GAGGTACTGAAACTAAATTCTGG - Intronic
1091926775 12:4357762-4357784 CAGGCCTTGAACCTGAATCCAGG - Intergenic
1103808209 12:123591420-123591442 GTGGCCCTGAACCTAATCAATGG - Intronic
1105624442 13:22099328-22099350 GAGGCACTGAATGTGAATACAGG - Intergenic
1107556673 13:41521514-41521536 GAGCCCCTGTACCTAGAAACTGG + Intergenic
1124010786 15:25836896-25836918 GTGGACCTGAAGGTAAATACTGG - Intronic
1131140489 15:89973142-89973164 GATGACCTGAACCTGAATCCTGG - Intergenic
1133644311 16:7748977-7748999 AAAGCCATGAAACTAAATACTGG + Intergenic
1135334758 16:21591920-21591942 GAGTCCTTCAACCTAAATCCTGG - Intergenic
1136126711 16:28188343-28188365 GAGCCCATGAACCTGAATATAGG - Intronic
1136274176 16:29168496-29168518 GATGCTCTAAACCTAAGTACTGG - Intergenic
1142733751 17:1881006-1881028 GAGGCCCAGAGCCTAAACCCTGG - Intronic
1144037196 17:11377663-11377685 GAAGCCCTGAACATAAATTGTGG + Intronic
1147521638 17:41178861-41178883 GAGGCCCTGAATCTGAATTTTGG - Intergenic
1149984199 17:61334982-61335004 GAGGTCCTGAACCTGAGCACAGG + Intronic
1150608929 17:66717642-66717664 GAGGCCCTGAAACTAGATGCTGG - Intronic
1152356519 17:79810208-79810230 AAGGGCAGGAACCTAAATACAGG - Intergenic
1156424233 18:36991745-36991767 GAGGCCCTGAACCAACATAGAGG - Intronic
1160822901 19:1066681-1066703 GAGGCCCAGAACCGAAACCCTGG - Intronic
925898594 2:8492714-8492736 GAGTCCCAGAATCTAAACACTGG + Intergenic
930045328 2:47165932-47165954 GGAGCCTTGAACCAAAATACTGG - Intronic
930245245 2:48977205-48977227 GAGGCCCAGAACATAAATCATGG + Intronic
935570442 2:104654696-104654718 GAGGCCAAGATCCTAATTACAGG - Intergenic
936511804 2:113154317-113154339 GAGGCCCTGAACTTACACAGGGG + Intergenic
937344974 2:121119830-121119852 GAGGCCCTAAACCCAATGACTGG + Intergenic
940419777 2:153466568-153466590 GAGGCACTGAACCTCATTAGAGG - Intergenic
941921146 2:170852095-170852117 GAGGCCCTGGACTTGAATCCAGG + Intronic
944076951 2:195743508-195743530 GAGGCCCAGACCCTAGAAACAGG + Intronic
946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG + Intronic
948657221 2:239484043-239484065 GTGCCCCTGAACTTAAATAAAGG + Intergenic
948732803 2:239977871-239977893 GAGGCACAGAACCTACATCCAGG - Intronic
1172606196 20:36215859-36215881 TATGCCCAGAACCTAAATACAGG - Intronic
1174371500 20:50091947-50091969 GAGGAACTGAACATAATTACAGG - Intronic
1175286905 20:57842875-57842897 GAGACCCTGAATCTAATTAAAGG - Intergenic
1177732351 21:25043900-25043922 AAGGCCCTGCCTCTAAATACTGG + Intergenic
1182977942 22:34640892-34640914 GAGGCCCTGCATCAAATTACTGG - Intergenic
1183709875 22:39496722-39496744 GAGCCCCTGGTCCTAAATCCTGG - Intergenic
955073953 3:55595297-55595319 GAGACACTGAAACTAAATAGTGG + Intronic
956902778 3:73733975-73733997 GCGGCCCTGAAACTGAAAACAGG + Intergenic
961824355 3:129591175-129591197 GATGCCCTGGACCAACATACAGG + Intronic
963395917 3:144733097-144733119 GAGGACGTCAACCTAAATATGGG - Intergenic
970706313 4:18807652-18807674 GAGCCCCTGAACCTCAAAAGTGG + Intergenic
976619506 4:87114229-87114251 GATGACCGGAACCTAAATTCTGG + Intronic
986194039 5:5521385-5521407 GTACCCCTGAACCTAAATAAAGG + Intergenic
990426051 5:55690290-55690312 GATGCCTTAAATCTAAATACAGG - Intronic
993254959 5:85578850-85578872 GATGCCCTGAAACTACATAAAGG + Intergenic
993641717 5:90413922-90413944 GAGGAACTGAAGATAAATACAGG + Intergenic
996967673 5:129323613-129323635 GAGGCCCTATACCCAAATACAGG - Intergenic
1001073658 5:168607692-168607714 GAGGCCCTGAGCCTAAGAAGGGG - Intergenic
1001801460 5:174547842-174547864 CAGGCCCTGACCTTAAAGACTGG - Intergenic
1002534776 5:179870119-179870141 GAGCCCCTGGCCCTAGATACGGG - Intronic
1009000935 6:57713719-57713741 GATGGCATGATCCTAAATACAGG + Intergenic
1010549666 6:77205904-77205926 AAGGACCTCAACCTAAATACCGG + Intergenic
1016604427 6:145903739-145903761 GAAACCCTGACCCTATATACTGG - Intronic
1024703150 7:51926653-51926675 GAGTCCCAGAATATAAATACTGG - Intergenic
1029412593 7:100424820-100424842 AAGGATTTGAACCTAAATACTGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1030120286 7:106103377-106103399 GAGGGCCTGAACAAAAATAGTGG - Intronic
1031395095 7:121263972-121263994 AAGGCCCTATTCCTAAATACAGG - Intronic
1032890008 7:136183911-136183933 TAGGCTCTAAACCTAAACACAGG + Intergenic
1039996453 8:42538498-42538520 GTGGCCCTGCACCTAAAAGCAGG + Intronic
1050842875 9:10174429-10174451 GAGGCCCTCAACAGAAATAGGGG + Intronic
1192341618 X:70268026-70268048 GAGGCCTTGAACCTGAGAACTGG - Intergenic
1201681797 Y:16654206-16654228 GAGACCCTGAACCTACTTATAGG + Intergenic