ID: 1080313900

View in Genome Browser
Species Human (GRCh38)
Location 11:30926440-30926462
Sequence CTGTCAGAAAGGTGGAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080313900 Original CRISPR CTGTCAGAAAGGTGGAAAAT GGG Intronic
902690333 1:18107105-18107127 CTGGCAAAAAGGTGGAAACTTGG + Intergenic
904105980 1:28084467-28084489 TTGATAGTAAGGTGGAAAATAGG - Intronic
904779231 1:32932642-32932664 CTTTCAAAAAGGTTGAAACTGGG - Intergenic
904802406 1:33103139-33103161 CTGTCTGCAGCGTGGAAAATGGG - Intronic
904887961 1:33755933-33755955 CTGTCCAAGAGGTGGAAACTGGG - Intronic
904948134 1:34214299-34214321 CTCTGAAAAAGGTGGAAAATAGG + Intronic
905207653 1:36352059-36352081 TTGTCATAAAGTTGGGAAATTGG - Intronic
905260071 1:36710857-36710879 CAGTCAGGAAAGTAGAAAATGGG - Intergenic
907519334 1:55012878-55012900 CTGTCAGACAGGTGTCAAACAGG + Intergenic
907581668 1:55577887-55577909 ATGTCAGGAGGGTGGAAAAATGG + Intergenic
907999909 1:59669694-59669716 CTATCAGAAGGCTGGAAATTGGG - Intronic
908060755 1:60346000-60346022 GTCTCAGAAAGGTTGAAGATGGG + Intergenic
908677914 1:66626835-66626857 CTGAAAGAAAGTTAGAAAATGGG + Intronic
911162459 1:94694752-94694774 GTGCCAGAAAGGTGGAAGGTTGG - Intergenic
911959188 1:104278055-104278077 CTGTCAGAAGGGTGGCAGACAGG + Intergenic
913494542 1:119416402-119416424 CTGTGAGGAAGGTAGAAAAGGGG + Intronic
915252618 1:154601376-154601398 CTGTCATAAAGTTAGAAAACAGG - Exonic
915646826 1:157278543-157278565 CTGTTAGGAAGGAGGAAAATCGG + Intergenic
915923656 1:159998684-159998706 TTGTCAGAAAGGAGGAAAAGGGG + Intergenic
916666886 1:166975122-166975144 TGGTCAGTAAGGAGGAAAATGGG + Intronic
917018537 1:170561483-170561505 CTTGCAGAAAGATGGAAAGTGGG - Intergenic
918202936 1:182284203-182284225 CTGTCAGAAGCCTGGAAACTTGG - Intergenic
918327457 1:183423810-183423832 CTGTCAGAAAGTTGAAATATTGG - Intergenic
919321408 1:196044603-196044625 CTGCAAGAAATGTGAAAAATAGG + Intergenic
919591743 1:199511975-199511997 CTTCCATAAAAGTGGAAAATGGG - Intergenic
920654292 1:207864207-207864229 AGGTCAAAAAGGTGGAAACTAGG + Intergenic
922984383 1:229854741-229854763 TTGACAGAAAGATGGAAAAAAGG - Intergenic
924090724 1:240498271-240498293 CTTTCAGGAAGGGGGAAAAGTGG + Intronic
1063585506 10:7349029-7349051 GAGTCAGAGAGGTGGAGAATGGG - Intronic
1066039037 10:31526384-31526406 ATGACAGCGAGGTGGAAAATGGG - Intronic
1067521614 10:47011873-47011895 CTGGCAGAGAGGAGGAAAAGTGG - Intergenic
1068321161 10:55418424-55418446 ATGTCTAAAACGTGGAAAATAGG + Intronic
1068817768 10:61336895-61336917 CTGTCAGAAAACGGGAAAAAAGG - Intergenic
1068831009 10:61494848-61494870 ATATCAGAAAGGTATAAAATAGG - Intergenic
1069082403 10:64102293-64102315 ATTTCAGAAAGGAGGAAAATGGG - Intergenic
1069118852 10:64543067-64543089 GAGTCAGAAAGGTTAAAAATTGG + Intergenic
1069231277 10:66011638-66011660 CTGTCAGAAATGTGTAGAGTAGG + Intronic
1069941853 10:71962112-71962134 CTGTCAGGGAGGGGCAAAATTGG + Intergenic
1070535449 10:77373980-77374002 CTGTGGGAAGGGTGGATAATGGG + Intronic
1073492840 10:103866210-103866232 CTACGAGAGAGGTGGAAAATGGG + Intergenic
1075111360 10:119587865-119587887 ATTTCAGAATGGTGAAAAATTGG - Intronic
1075926025 10:126252383-126252405 CTGTCTGCAAGCTGGAAAACTGG + Intronic
1076084785 10:127617690-127617712 TGGGCAGAAAGGTGGAGAATGGG + Intergenic
1076688526 10:132208983-132209005 GTGGCAGAGAGGAGGAAAATGGG - Intronic
1078463371 11:11532085-11532107 GTGTCAGAATGGGAGAAAATGGG - Intronic
1078931560 11:15915898-15915920 CTGTCTGAAAGGGGAAGAATTGG + Intergenic
1080028068 11:27633623-27633645 CTTCCAGAAAAGTGGAAAAAGGG + Intergenic
1080313900 11:30926440-30926462 CTGTCAGAAAGGTGGAAAATGGG + Intronic
1081338965 11:41903882-41903904 CTGTAAAAAAGAAGGAAAATGGG + Intergenic
1081685494 11:45040068-45040090 CTGGCAGAGAGGAGGAAAATTGG - Intergenic
1081987543 11:47317042-47317064 CTGAAAGAAAGGAGAAAAATAGG - Intronic
1082864407 11:57885590-57885612 CTGTGAGAAGGGTGGAGAAGAGG - Intergenic
1082929515 11:58586274-58586296 CTTGAAGAAAGGTGGAAATTTGG + Intronic
1084355334 11:68634649-68634671 CCCGCAGAAAGGTGGAGAATGGG - Intergenic
1084613493 11:70219098-70219120 CTTACAGAAAGGTGGAGAAGGGG + Intergenic
1084733885 11:71092070-71092092 CTGTCAGGACGGTGGGAACTTGG + Intronic
1085542493 11:77285354-77285376 GTGTAAGAAAGGTTGTAAATAGG - Intronic
1086080167 11:82895813-82895835 CTGTGACAAAGGTGGGAAAGGGG + Intronic
1087612356 11:100449552-100449574 CTGTCAGAAAAGAGGAAAAGGGG + Intergenic
1088127415 11:106445627-106445649 TTGTCAGCAATGTGGAGAATGGG + Intergenic
1088367575 11:109055338-109055360 CTGTCAGAAAATTAGATAATTGG + Intergenic
1088721049 11:112592014-112592036 CTGTCTGACAGGAGGAATATGGG + Intergenic
1089829164 11:121310149-121310171 CTGGGAGAAAGATGGAAACTAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091227177 11:133964680-133964702 CACTCAGAAAGGTGGAAAGGAGG + Intergenic
1094358933 12:29609065-29609087 CTTCCAGAGAGGTGGAAAATAGG + Intronic
1095239142 12:39836403-39836425 TTTTCAGAAAGGGAGAAAATCGG + Intronic
1095692259 12:45103466-45103488 TTGTCACAAAAGTGAAAAATTGG + Intergenic
1096577035 12:52559167-52559189 CTGTCAGAAATATGGCAAAATGG - Intergenic
1098151057 12:67547096-67547118 GAGTCAGAAAGGTGGAAAATGGG - Intergenic
1098896329 12:76065818-76065840 CTGTCAAAAATGTGGATGATTGG + Intronic
1099322933 12:81174121-81174143 GTTTCTGAAAAGTGGAAAATAGG - Intronic
1099343468 12:81468440-81468462 CTGTCAGAGCTGTTGAAAATTGG - Intronic
1100558236 12:95719823-95719845 CTGTCAGAATGGGGCAAAATAGG + Intronic
1101080022 12:101172656-101172678 CTGTCTGAAAGGTGCAAAGAAGG + Intronic
1102945529 12:116984408-116984430 CTGGGAGAAGAGTGGAAAATCGG + Intronic
1103143913 12:118577470-118577492 ATGTCAGAAAGGGGTAAAACTGG - Intergenic
1103257454 12:119554294-119554316 CTGTCTGCAGGGTGGAGAATGGG + Intergenic
1107591501 13:41911457-41911479 ATGTCAGAAAGGGGAAACATGGG + Intronic
1108013745 13:46051892-46051914 CTGTCAGAAACGGGGGAAAGTGG - Intronic
1108787185 13:53919018-53919040 AGGGCAGAAAGGAGGAAAATAGG + Intergenic
1109495296 13:63162922-63162944 ATGTCAGAAAGATATAAAATAGG - Intergenic
1110550254 13:76804157-76804179 CTGTTAGAAAGGGGAATAATAGG - Intergenic
1110719203 13:78742557-78742579 CAGTCAGAAAGGTTGAAAGGTGG - Intergenic
1111572412 13:90105053-90105075 CTGTCACAAGGGTGGAAGAATGG - Intergenic
1113104182 13:106755467-106755489 CTGGCAGATAAGTGCAAAATTGG - Intergenic
1113798472 13:113074287-113074309 CAGTCAGACAGGTGCAAAGTCGG - Intronic
1115941140 14:38611135-38611157 TTATCAGAAAGATGAAAAATAGG + Intergenic
1116439642 14:44937475-44937497 ATGTCAGAGAATTGGAAAATTGG + Intronic
1116944979 14:50828823-50828845 CTGTCACAGAGGGGGAGAATAGG - Intronic
1116974151 14:51096476-51096498 CTGTCTGGAAGGTGGAAAATTGG - Intergenic
1117006622 14:51427149-51427171 CTTATAGCAAGGTGGAAAATCGG + Intergenic
1117814467 14:59582865-59582887 CTGTCACAGAGGTGGGAAATTGG + Intergenic
1117919102 14:60709102-60709124 CTTTCAATAAGGTTGAAAATAGG + Intergenic
1118216466 14:63813459-63813481 AAGTCACAAGGGTGGAAAATTGG - Intergenic
1118878563 14:69806734-69806756 TTTTCAGAAAGGTTGAAAATAGG + Intergenic
1120202791 14:81555307-81555329 ATTTCAGAAAGGTGGAAAAAAGG - Intergenic
1121982183 14:98464432-98464454 CTGTCAGAAGGGTGAAAAGATGG + Intergenic
1125509867 15:40287094-40287116 CTGGCAGAAGGGTTGAACATAGG + Intronic
1125550667 15:40542115-40542137 ATGTCAGAAAGGTTGTAAAGGGG - Intronic
1125978441 15:43977319-43977341 CAGTCACCAAGGTGGAAAAATGG + Intronic
1128405020 15:67327896-67327918 CTGTCATAAAAGCTGAAAATAGG - Intronic
1128742803 15:70095721-70095743 GTGTCAGGAAAGTGGAAAAGTGG - Intronic
1129069049 15:72936036-72936058 CTGCCAGTCAGGTGGAGAATGGG + Intergenic
1131792727 15:95982534-95982556 CTGTCAGAATAATGGAGAATTGG - Intergenic
1131792970 15:95984702-95984724 TTGAAAGAAAGCTGGAAAATAGG + Intergenic
1133753300 16:8741999-8742021 CTATCAGAAAGGGGGGGAATGGG - Intronic
1134268557 16:12713042-12713064 CTCTCAGAAAGAGAGAAAATGGG + Intronic
1134742832 16:16563291-16563313 TTGGCAGAATGGTGGCAAATTGG + Intergenic
1134760520 16:16710210-16710232 CTTACAGAAATGTGGACAATGGG - Intergenic
1134985539 16:18648963-18648985 CTTACAGAAATGTGGACAATGGG + Intergenic
1135109399 16:19678940-19678962 CTGTCAAAAAGGTGGTACAAGGG - Intronic
1135304933 16:21359889-21359911 CTGTGAGTAAAGTGGAGAATTGG + Intergenic
1135811072 16:25587321-25587343 CTTTCAGAAAGGCAGAAGATGGG - Intergenic
1135913787 16:26585026-26585048 CTGTAAGAAAGGCTGAAAAGTGG + Intergenic
1136301684 16:29339082-29339104 CTGTGAGTAAAGTGGAGAATTGG + Intergenic
1136481768 16:30546452-30546474 CTGTCGGGGAGGGGGAAAATTGG + Intronic
1137245794 16:46703452-46703474 CTGTCAGATTGGTGAAGAATTGG - Intergenic
1137297582 16:47110932-47110954 CCGTGAGAATGGTGGAAAATTGG + Intronic
1141286383 16:82676359-82676381 CTGTGAGAAAGGGGAAAAACTGG - Intronic
1142063368 16:88045641-88045663 CTGTGAGTAAAGTGGAGAATTGG + Intronic
1143659912 17:8318451-8318473 CTGTCAGCAAGGTGGGCAGTGGG + Exonic
1145931583 17:28689829-28689851 CTGTTAGAAAGGAGGAAAGGGGG - Intronic
1146459658 17:33035877-33035899 TTGCCAGAAAGGCTGAAAATTGG - Intronic
1148456582 17:47814509-47814531 CTGTCAGAAAGGTGCCAGCTGGG - Exonic
1149000132 17:51748842-51748864 GTGTCAGAAAGGTGGAAAAGAGG - Intronic
1149700465 17:58650801-58650823 CAGTGGGATAGGTGGAAAATTGG + Intronic
1149944584 17:60908865-60908887 ATGTCTGAAAGGTGGAAAACAGG - Intronic
1150542387 17:66116018-66116040 CTGTAAGAAATGTGGAAACCTGG - Intronic
1151198616 17:72451173-72451195 AGGTCAGAAAGGTTGAACATGGG + Intergenic
1153113473 18:1623216-1623238 CTGTCAGTAATGGGGAAACTGGG + Intergenic
1153128269 18:1822986-1823008 CTATCAGAAAGCAAGAAAATGGG + Intergenic
1153553956 18:6291147-6291169 AAGTCAGAAAGGTAGAAAAAGGG - Intronic
1153771278 18:8418646-8418668 ATTCCAGAAAGGTGAAAAATAGG - Intergenic
1155960563 18:31991424-31991446 CTGTTAAAAAGTTGGAAAATAGG - Intergenic
1157688430 18:49661569-49661591 GTGTCAGAGAGTTGGAGAATTGG + Intergenic
1157943545 18:51954978-51955000 TTGTCAGAAGTCTGGAAAATGGG + Intergenic
1158117189 18:54009089-54009111 CTGACAAAAAAGTGGAAAAAAGG + Intergenic
1158582258 18:58694051-58694073 TGGTAGGAAAGGTGGAAAATGGG - Intronic
1158801309 18:60913401-60913423 CTGTTACAAAAGTGTAAAATAGG - Intergenic
1159545322 18:69833913-69833935 CTGTCAAGGATGTGGAAAATGGG + Intronic
1161340567 19:3739738-3739760 CTCTGGGAAAGGTGGAAAATTGG - Intronic
1164123012 19:22285203-22285225 CTGGAAGAAAGGTGGAAAATGGG + Intergenic
1164307929 19:24021246-24021268 CTGGAAGAAAGGTGGACAACAGG - Intergenic
1166540323 19:43600872-43600894 CAGTTAGGAAGGTGGAAAAAAGG - Exonic
1168368259 19:55808455-55808477 CTGTCACAAACGGGGAAAAGGGG + Intronic
927739474 2:25554924-25554946 CTCTGAGGAAGGAGGAAAATGGG + Intronic
927811564 2:26183245-26183267 ATGTCAGAAGGGTGGGGAATAGG + Intronic
930357360 2:50338121-50338143 CTGTCAGCAAAGTGGCTAATTGG - Intronic
930877371 2:56233914-56233936 CTGTCAGAAAGGGGAAAAGTTGG + Intronic
930903292 2:56534117-56534139 CTGTCTGTAAGCTGGAGAATTGG + Intergenic
933460979 2:82585079-82585101 CTGTCAGGAAGGAGGGCAATGGG - Intergenic
936851447 2:116903542-116903564 CAGTAAGTAAGGTGGAAAAAAGG - Intergenic
937491923 2:122378615-122378637 GAGTCAGAGAAGTGGAAAATTGG + Intergenic
937843316 2:126549565-126549587 CTCTCAGCAAGGTAGAATATGGG + Intergenic
940676035 2:156724904-156724926 CTGCTAGAAAGGTGGAGAAGGGG + Intergenic
941161038 2:162034468-162034490 CTGTAAGAAATTTGGAAAAGGGG - Intronic
941572518 2:167189757-167189779 GTGTCAGAGAGTTGGAGAATTGG - Intronic
941733714 2:168948768-168948790 ATTTCAGAAAGGTAGAGAATCGG - Intronic
941788676 2:169526523-169526545 CTGTCAGAAATTTAGCAAATAGG - Intergenic
942849816 2:180471370-180471392 CTGTTAGAAAGATGGAAAAGGGG - Intergenic
943129979 2:183842257-183842279 CTGCCAGAAAAGTTCAAAATGGG + Intergenic
944387227 2:199180329-199180351 CCCCCAGAAAGGTGGAAAAGGGG - Intergenic
944954115 2:204787861-204787883 ATGACAGAAAACTGGAAAATGGG - Intronic
945246303 2:207720298-207720320 CTGAAAAAAAGGTGGAAAAAAGG - Intronic
947304115 2:228724483-228724505 ATGTCAGAGAGATGGAACATAGG + Intergenic
948622901 2:239247672-239247694 GTGGCAGGAAGCTGGAAAATAGG + Intronic
1168774029 20:433638-433660 GTGTCAGAGAGCTGGAAAAGTGG - Intergenic
1174199856 20:48799672-48799694 ATTTTAGATAGGTGGAAAATGGG + Intronic
1175735946 20:61386991-61387013 ATCTCAGAGACGTGGAAAATTGG - Intronic
1177715259 21:24832149-24832171 TTTTCAGAGTGGTGGAAAATAGG - Intergenic
1178690913 21:34748893-34748915 CTGTCTGAATGGTGGATGATGGG - Intergenic
1179223531 21:39431150-39431172 CTGTGAGAAAGGTGGTGGATTGG + Intronic
1181751436 22:24991759-24991781 ACGTCAGAAAGGAGGAAACTGGG - Intronic
1185008030 22:48296745-48296767 CTGGCAGAAATGTGAAGAATTGG - Intergenic
949991432 3:9582509-9582531 CTCTGGGAAAGGTGGAAAAGTGG + Intergenic
950317873 3:12021173-12021195 ATGTCATAATGGTGAAAAATTGG - Intronic
951303825 3:21032733-21032755 TTGTTAGAAAGGTGTACAATGGG + Intergenic
952765723 3:36952477-36952499 CTATTAGAAAAGTGGGAAATGGG - Intergenic
954915097 3:54142120-54142142 ATGACAGAAAGGTGGAAGAGGGG + Intronic
955521419 3:59779023-59779045 CTGTTAGAAAGGAAGAGAATGGG + Intronic
955590275 3:60527462-60527484 CTATCAGAAAGGAGAAAAATTGG + Intronic
958267486 3:91456188-91456210 CTGTCAGCAAGCTGGAGACTCGG - Intergenic
958588800 3:96126223-96126245 TTGACAGAGAGGTGGAAAAATGG + Intergenic
959193809 3:103151025-103151047 CTCTCAGTAAGCTGGAAAAGTGG - Intergenic
959265394 3:104131286-104131308 TTTTTAAAAAGGTGGAAAATTGG - Intergenic
960026407 3:113015941-113015963 CTGCCAGAAAGGCTTAAAATGGG + Intronic
960029406 3:113042266-113042288 GAGTAAGAAAGTTGGAAAATAGG - Intergenic
961552946 3:127679550-127679572 CTGTCAGAATGGTGGGACAGAGG - Intronic
961909734 3:130302252-130302274 CTGTAAAAAAGAAGGAAAATGGG + Intergenic
963089897 3:141474199-141474221 TTATCTGAAATGTGGAAAATGGG + Intergenic
964700924 3:159565367-159565389 CTTCAAGGAAGGTGGAAAATGGG - Intronic
965667130 3:171107092-171107114 CATTCAGAAAGGTGGCCAATGGG - Intronic
965676487 3:171202366-171202388 TTTTCAGACAGGTTGAAAATAGG + Intronic
966155798 3:176915055-176915077 CAGACAGGAAGGAGGAAAATTGG + Intergenic
966363283 3:179152724-179152746 CAGTCAGCAAAGTGGAAAATAGG - Intronic
967926466 3:194652747-194652769 CTGGGAGAAAGGTGAAAGATGGG - Exonic
969351561 4:6600925-6600947 GTGTCAGAAAAGTGGAGAATTGG - Intronic
969951049 4:10835912-10835934 CTGTCATAGAGGTGGAACATGGG + Intergenic
970287717 4:14536640-14536662 GAGTCAGAAAGGTTGACAATTGG - Intergenic
970903144 4:21183607-21183629 CTGGCAGATATGTGGAAAAAAGG - Intronic
971723795 4:30282176-30282198 CTGTCAACAAGCTGGGAAATGGG + Intergenic
972260662 4:37405170-37405192 CTGTCATAAAGATATAAAATGGG - Intronic
972463802 4:39332501-39332523 TTGTTAGAAATGTAGAAAATGGG - Intronic
974133844 4:57790072-57790094 CTGTCAGACAAGTAGAAAAATGG - Intergenic
974991645 4:69098779-69098801 CTGAAAGAAAGATGGGAAATGGG + Intronic
975222232 4:71826016-71826038 CTGTTAGTAACATGGAAAATAGG - Intergenic
975876508 4:78844490-78844512 GTGTCAGAAAAGGAGAAAATTGG + Intronic
976890553 4:90041310-90041332 CGGTCACAGAGATGGAAAATGGG - Intergenic
977087418 4:92620039-92620061 ATGTCAGAAATGTGGATTATGGG + Intronic
978722895 4:111934185-111934207 CTGTCAAAAATATGAAAAATAGG - Intergenic
981204055 4:142018027-142018049 CTGCCACAAAGGTGGAAAGATGG + Intergenic
981957439 4:150495156-150495178 CTGTGACAGAGGAGGAAAATGGG - Intronic
984648556 4:182244780-182244802 CTCTCAGAAAGCTGGACAGTTGG - Intronic
984655548 4:182313908-182313930 CTGGCTGAAGGATGGAAAATAGG - Intronic
984840764 4:184065274-184065296 CACTTAGAAAGGTGGAAAAGAGG + Intergenic
986874578 5:12092901-12092923 TTGCCATAAAGGTGGAATATTGG + Intergenic
986968949 5:13309371-13309393 TTGTCTGAAAGGTAGAAAGTTGG + Intergenic
987470944 5:18326518-18326540 ATGTCAGAAAGTTGTAAAAACGG + Intergenic
990169995 5:53037442-53037464 CTGTTACCAAGGTGGGAAATTGG - Intronic
991362605 5:65836551-65836573 CTGTTAGGAAGGAGGAAAAAGGG - Intronic
994379829 5:99057781-99057803 CAGGCAGAATGATGGAAAATGGG + Intergenic
994779177 5:104069087-104069109 CTTCCAGAAAAGTGGAAAAAGGG + Intergenic
994906080 5:105842227-105842249 CTGTCAAAAAGAAGGAAAATGGG + Intergenic
995102128 5:108324961-108324983 AAGTCAGAAAGGCAGAAAATAGG + Intronic
995731482 5:115247697-115247719 ATGTGTGAAATGTGGAAAATAGG - Intronic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
998795729 5:145816380-145816402 CTGTCAAGAAGGTGAAAAACAGG - Intronic
998937099 5:147240906-147240928 CAGTGAGAAAGGTGGAAAGTAGG + Intronic
999499080 5:152128752-152128774 TTTTCAGAAAGGGGTAAAATTGG - Intergenic
999931572 5:156438720-156438742 CTTTCAAAAATGTTGAAAATGGG - Intronic
1001033161 5:168277501-168277523 GAGCCAGAAAGGTGGCAAATGGG - Intergenic
1002090485 5:176802732-176802754 TTATCAAACAGGTGGAAAATGGG - Intergenic
1002332204 5:178451111-178451133 CTGTTAAAAAAGTGGAAAAGAGG + Intronic
1003479342 6:6516894-6516916 CTGTCAGCCAGATGGAAACTGGG - Intergenic
1006079349 6:31556327-31556349 CTGGCAGAAAGCTGGAATAGGGG - Intronic
1007610586 6:43146393-43146415 CAGTTAGAAAGGAGGAGAATTGG - Intronic
1008630734 6:53360900-53360922 CTGCCAGGCAGTTGGAAAATTGG - Intergenic
1008880248 6:56374301-56374323 CTGTCAAAAGGCTGGTAAATAGG - Intronic
1008987731 6:57565416-57565438 CTGTCAGCAAGCTGGAGACTCGG + Intronic
1009176335 6:60464016-60464038 CTGTCAGCAAGCTGGAGACTCGG + Intergenic
1010586861 6:77665084-77665106 CTGCCAGAAAAGTGGGAAAAGGG + Intergenic
1012627631 6:101423430-101423452 CTGTCGAGAATGTGGAAAATTGG - Intronic
1012869050 6:104652295-104652317 ATGCCAGAAAGGGGGGAAATGGG + Intergenic
1013300998 6:108804777-108804799 GTTTGAGAAAGGAGGAAAATAGG + Intergenic
1014614891 6:123587080-123587102 CCCCCAGAAAGGTGGAAAAGAGG + Intronic
1014837221 6:126173326-126173348 CTGACAGAAAGGTGGAAACGGGG - Intergenic
1015972639 6:138758175-138758197 CTGACAGGAAGAAGGAAAATAGG + Intronic
1016975865 6:149806953-149806975 CAGTAAGAAAGGTGGAAAGCTGG - Intronic
1017576957 6:155816007-155816029 CTGGCAGAAATGTGGCATATGGG - Intergenic
1019546903 7:1582267-1582289 CAGTCAGGAAGATGGACAATGGG - Intergenic
1020142148 7:5618197-5618219 ATCTCAGAAAGATGGAAAAAAGG + Intergenic
1020154746 7:5713491-5713513 GTTTCAGAATGTTGGAAAATGGG + Intronic
1020220991 7:6236861-6236883 CTGTCAGAAAAATGGAGACTTGG - Intronic
1020442803 7:8236649-8236671 AGGGCACAAAGGTGGAAAATAGG + Intronic
1020816593 7:12913060-12913082 CTGAAAGGAAGGGGGAAAATTGG + Intergenic
1022391714 7:29949677-29949699 CTGTCTGAAAGAAGGAAAAAAGG - Intronic
1023613941 7:41999535-41999557 GTGTCTGAAAGGTGTAAAAGAGG - Intronic
1023699057 7:42875157-42875179 CTGCCAGAAAAGTGGGAAAAGGG + Intergenic
1024571794 7:50729384-50729406 CTTTCAGAAAAATGCAAAATAGG - Intronic
1024602760 7:50999123-50999145 GTGTCAGAAATGGGGAACATAGG + Intergenic
1027810037 7:82884702-82884724 ATGTCACAAAATTGGAAAATAGG + Intronic
1028548935 7:92034847-92034869 CTGACAAAAAGGTGAGAAATAGG - Intronic
1030581603 7:111363273-111363295 CTGTTAGAAATGTGGAATTTGGG + Intronic
1030859501 7:114607058-114607080 ATGTCAGAAAGGAGGAGAATAGG + Intronic
1032083560 7:128872221-128872243 CTGGCTGAAGGGTGGCAAATAGG + Intronic
1034080790 7:148275983-148276005 CATTCAGAATGGTGGAAAGTCGG + Intronic
1034246312 7:149647130-149647152 CTGGCAGGCAGGTGTAAAATAGG - Intergenic
1036410910 8:8499672-8499694 ATGACAGAAAGATGGAAAATGGG + Intergenic
1038195109 8:25360180-25360202 ATGGCAGAAAGGTGGGTAATGGG - Intronic
1038691459 8:29767516-29767538 CTGTCGGCAAGGTAGAAATTAGG + Intergenic
1038871269 8:31496495-31496517 CTGGCAGAAGTGTTGAAAATGGG + Intergenic
1039410669 8:37352600-37352622 CTGTCAAGAAGGAGGAAAAATGG + Intergenic
1043153747 8:76751515-76751537 CTGACATAAAGATGGCAAATAGG - Intronic
1043427108 8:80158350-80158372 CTGCCAGAGTGGTGGATAATGGG + Intronic
1044138468 8:88617681-88617703 CTGAGAAAAAGGTAGAAAATTGG + Intergenic
1044154170 8:88823248-88823270 GTGGCAGAAAGGTTGAAGATTGG + Intergenic
1047011888 8:120681568-120681590 CTCTCAGAACAGTGGAAAGTGGG + Intronic
1047093801 8:121601988-121602010 CTGTTAGAAAGGTGCAAGAGTGG + Intergenic
1048018255 8:130516457-130516479 CTGTCAGATGGTTGGAAAAGAGG + Intergenic
1048163714 8:132043503-132043525 TAGTCAGAAAGGTAGAGAATGGG - Intronic
1051336519 9:16070795-16070817 CGGTCAGAGAGGTGGAGAGTGGG - Intergenic
1053125429 9:35577062-35577084 CTGTAAAAAAGAAGGAAAATCGG + Intergenic
1053160088 9:35808108-35808130 CTGTCAGAGAGGAGGAAAGCAGG - Exonic
1055803340 9:80065463-80065485 CTGCCAGAAGGGGGGAAAAAAGG + Intergenic
1057868217 9:98698364-98698386 AAATCAGAAAGGTAGAAAATCGG + Intronic
1059339033 9:113587033-113587055 GTGTCAGGAAGGTGAGAAATGGG - Intronic
1060010106 9:120036392-120036414 CTCTATGAAAGGTGGAAAAAAGG - Intergenic
1060032975 9:120231664-120231686 CAGTGAGCAAGGTGGAAAATGGG + Intergenic
1061637050 9:131918602-131918624 CTGTCAGAAAACTGAAAAACAGG + Intronic
1186307824 X:8283181-8283203 ATGTAAGAAACATGGAAAATAGG - Intergenic
1186923949 X:14311606-14311628 CTGGGGGAGAGGTGGAAAATGGG + Intergenic
1187060919 X:15786508-15786530 TAGACATAAAGGTGGAAAATGGG + Exonic
1188346390 X:29071700-29071722 CTGTCATAAAGGAAGAAAAGGGG - Intronic
1189207076 X:39250822-39250844 CTGTCAGCCAGGTGGCTAATGGG + Intergenic
1193982078 X:88194040-88194062 CTGTCAAAGATGTGGAGAATAGG + Intergenic
1195313771 X:103658144-103658166 CTGTAAAAAAGAAGGAAAATGGG - Intergenic
1196133221 X:112180134-112180156 CTATCAGAAAAGTGGAAGAGGGG - Intergenic
1196736943 X:118988563-118988585 CTGGCAGACAGGTGAAAAAGGGG - Intronic
1197845201 X:130794138-130794160 CTGTCACTCAGGTGGAAAATTGG - Intronic
1198243893 X:134810472-134810494 CTGTCAGAAAGAAGTAACATAGG + Intronic
1198271631 X:135061225-135061247 CTGTAAAAAAGAAGGAAAATGGG + Intergenic
1198692347 X:139298075-139298097 TGGTCAGAAAGCTGGAAAGTGGG - Intergenic
1199620330 X:149695018-149695040 TTATCAGAAAGGTGGAAAATTGG - Intronic
1200235400 X:154465598-154465620 GTGGCAGAAAAGTGGAAAGTGGG - Intronic
1201495151 Y:14584691-14584713 CTGGCAGTTTGGTGGAAAATTGG + Intronic