ID: 1080314746

View in Genome Browser
Species Human (GRCh38)
Location 11:30936219-30936241
Sequence GGCTACAGATCTTCCTACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 2, 1: 5, 2: 10, 3: 11, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080314746_1080314750 16 Left 1080314746 11:30936219-30936241 CCATAGTAGGAAGATCTGTAGCC 0: 2
1: 5
2: 10
3: 11
4: 79
Right 1080314750 11:30936258-30936280 GTCCATATAATAACTCATAGAGG 0: 1
1: 5
2: 11
3: 8
4: 111
1080314746_1080314751 17 Left 1080314746 11:30936219-30936241 CCATAGTAGGAAGATCTGTAGCC 0: 2
1: 5
2: 10
3: 11
4: 79
Right 1080314751 11:30936259-30936281 TCCATATAATAACTCATAGAGGG 0: 1
1: 1
2: 4
3: 26
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080314746 Original CRISPR GGCTACAGATCTTCCTACTA TGG (reversed) Intronic
905613733 1:39378473-39378495 GCCTACAGAGCTTCCTACAGAGG - Exonic
909113575 1:71508021-71508043 AGCTACAAATCTCCCTACTATGG + Intronic
911385428 1:97169454-97169476 GGAAGCACATCTTCCTACTAAGG - Intronic
913993362 1:143635233-143635255 GGATGCAGATCTAGCTACTAAGG + Intergenic
914086209 1:144456261-144456283 GGATGCAGATCTAGCTACTAAGG + Intronic
914192103 1:145420212-145420234 GGATGCAGATCTAGCTACTAAGG + Intergenic
914590010 1:149098162-149098184 GGATGCAGATCTAGCTACTAAGG + Intronic
914989063 1:152482607-152482629 GGCTACAAAGCTTCCTACTATGG - Intergenic
915620863 1:157083217-157083239 GTCTACTGTACTTCCTACTAGGG - Intergenic
920009001 1:202854213-202854235 AGCTAAAGATCTTCCTAATATGG + Intergenic
924805400 1:247357687-247357709 GGCTACAGATCCTCCCACTATGG + Intergenic
1062761465 10:25098-25120 GTCTACAGATCTTTGTACTCTGG + Intergenic
1065982282 10:30911856-30911878 GGCTCCAGTCCTTCCTACTCTGG + Intronic
1073515159 10:104069621-104069643 GACTACTGATCTTCCTACTATGG + Intronic
1073679957 10:105692366-105692388 ATCTACAGATCTTCTTATTATGG - Intergenic
1076018230 10:127046322-127046344 GTCTGCAGATCCTCCTGCTACGG - Intronic
1078228023 11:9411039-9411061 AGCTACCCATCTTCCTGCTAAGG + Intronic
1079118623 11:17658895-17658917 TTCTACAGATTTACCTACTATGG - Intergenic
1080314746 11:30936219-30936241 GGCTACAGATCTTCCTACTATGG - Intronic
1085940298 11:81199736-81199758 GGCCACAGATCTTCCTACTATGG + Intergenic
1091998306 12:5012827-5012849 GTTTACAGATTTTCCTACTCTGG + Intergenic
1092332944 12:7602301-7602323 AGCTACAGATCTTCCTACTAGGG + Intergenic
1093623428 12:21319486-21319508 GGTTGCAGAGCATCCTACTATGG - Intronic
1109798161 13:67342999-67343021 AGCTACAGATCTTCCTACTATGG - Intergenic
1111586655 13:90291154-90291176 GGCTACAGATCTTCTTACTACGG + Intergenic
1111619853 13:90710519-90710541 CGCTACAGATCTTGTTTCTATGG + Intergenic
1112361935 13:98726376-98726398 TGCGAAAGATTTTCCTACTATGG - Exonic
1115766447 14:36627989-36628011 GGTCTCAGATCTTCTTACTAGGG + Intergenic
1117564841 14:56983147-56983169 GGCTACAGAACTTCAGTCTATGG - Intergenic
1122074969 14:99230130-99230152 GGCTCCAGAGCTCCCTAGTAGGG - Intronic
1126929992 15:53637049-53637071 GGCTACAGATTTTCCTTTTTTGG + Intronic
1127789742 15:62389626-62389648 GGCTTGAGATCTTCCTGCTTTGG + Intergenic
1129367736 15:75067128-75067150 AGCTACAGATCTCCCTACTATGG + Intronic
1140618800 16:76701795-76701817 GGGTACAGATCTTGTTACTCAGG + Intergenic
1146450616 17:32971176-32971198 AGCTACAGATCTCCCTACTATGG + Intronic
1148184183 17:45629730-45629752 GGCAACAGAGCAGCCTACTATGG - Intergenic
1151128170 17:71867389-71867411 GGCTATAGAACTTCCTGCTATGG - Intergenic
1151569526 17:74919371-74919393 GGGTACAGATCTGCCTATTCAGG - Intronic
1152954372 18:25428-25450 GTCTACAGATCTTTGTACTCTGG + Intergenic
1153734014 18:8045606-8045628 CTCTACAGATTTTCCTACTCTGG - Intronic
1156586323 18:38434945-38434967 GGCCACAGATCAACCTAGTATGG + Intergenic
1157281149 18:46347131-46347153 AGCTACAGCTCTTCCTCCTCGGG - Intronic
1157327975 18:46682577-46682599 GGCTATTACTCTTCCTACTATGG - Intronic
1158175912 18:54655453-54655475 GCCTACAGTCCTACCTACTAGGG - Intergenic
1158296809 18:56006681-56006703 GGCTAAAAATCTTCCCACCATGG + Intergenic
1166696461 19:44854464-44854486 GGGCCCAGATCTTCCTTCTAAGG - Intronic
1168510866 19:56972638-56972660 GGCTACAGAGTATCCGACTAGGG - Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
926935719 2:18085178-18085200 GACTACTGACCTTCCTACTATGG - Intronic
928366880 2:30709643-30709665 GGCCACACAGCTTCCTACTGAGG + Intergenic
935102761 2:100012303-100012325 GGCTACAGAGCTACCCACCAAGG - Intronic
936809143 2:116375063-116375085 TGCTACAGATTTTTCTACTCTGG - Intergenic
945746658 2:213726376-213726398 GCCTACAGTACTTCCAACTAAGG - Intronic
946656495 2:221953701-221953723 GGCATCAAATCTTCCAACTAAGG + Intergenic
1170315654 20:15038735-15038757 GTCTTCAGATCATCCAACTAGGG - Intronic
1178964359 21:37102247-37102269 GTTTCCAGATCTTCCAACTAAGG - Intronic
1179086696 21:38224789-38224811 GGCTAAAACTATTCCTACTAAGG + Intronic
1182369088 22:29798425-29798447 GGCTGCAGCTGTTTCTACTATGG - Intronic
1182606715 22:31511420-31511442 GGCCACAGAGCTTCATATTAAGG - Intronic
1183718268 22:39547015-39547037 GCCCACAGTTCTTCCCACTAGGG - Intergenic
949554826 3:5143839-5143861 AGCTACAGATCTTCCTACTTTGG - Intronic
952610564 3:35203821-35203843 GCTTACAGCTCTTCCTATTAAGG - Intergenic
953811146 3:46113892-46113914 AGCTACAAATCTCCCTACTATGG - Intergenic
954037976 3:47863339-47863361 GGCTACAGCTCTCCCTCCTTAGG + Intronic
962825211 3:139094924-139094946 GGGGACAGATCTTCCAGCTAAGG + Intronic
963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG + Intergenic
975719788 4:77238416-77238438 GGATAAAAATCTTCATACTAAGG + Intronic
977800631 4:101226106-101226128 TGTTAAAGACCTTCCTACTAGGG - Intronic
978969755 4:114788757-114788779 GGGTACAGAGCTTCTTACTGGGG + Intergenic
980522285 4:133949867-133949889 GGCTACTGACCTTCCTACTATGG - Intergenic
981300163 4:143178161-143178183 AGCTACAGATCTTCCTACTATGG - Intergenic
981398316 4:144280888-144280910 GGCAACAAATTTTGCTACTAAGG - Intergenic
984808807 4:183776058-183776080 GGGTACAGAACTTGCTGCTATGG - Intergenic
988570928 5:32365046-32365068 TTCTACAGATTTGCCTACTATGG + Intronic
996461354 5:123747087-123747109 GCCTACAGAACTTCCTCCCATGG + Intergenic
996655148 5:125926303-125926325 TACTACAGATCTTCCTACTACGG + Intergenic
997064356 5:130544529-130544551 AGCTACAGATCTCCCTACTATGG - Intergenic
999035742 5:148347244-148347266 TGCTACTGATCTTCCCTCTAAGG + Intergenic
1004239866 6:13911131-13911153 GTCTACAGATTTGCCTACTCTGG - Intergenic
1006054499 6:31373389-31373411 GGGTACAGAGTTTCCTTCTAGGG + Intergenic
1007647929 6:43397111-43397133 AACTACTGACCTTCCTACTATGG + Intergenic
1010742685 6:79526888-79526910 AGCTACAAATCTCCCTACTATGG + Intronic
1011261992 6:85479589-85479611 GGCCAGAGGTCTTCCTACAAAGG - Intronic
1013675145 6:112451312-112451334 GTCTACAGATTTTCCTATTCTGG + Intergenic
1016270717 6:142286706-142286728 GTCTACATTTCTTCCTAATAAGG - Intergenic
1016888562 6:148982533-148982555 GGATACAAAGCATCCTACTATGG - Intronic
1018418109 6:163619082-163619104 GGCTGCAGATCTTCATCCTGAGG - Intergenic
1018418111 6:163619103-163619125 GGCTGCAGATCTTCATCCTGAGG - Intergenic
1020963040 7:14829864-14829886 GGCTACAGTTATTGCTACTTCGG + Intronic
1021070732 7:16236624-16236646 GGCTACAGATCTTAATCCTAAGG + Intronic
1021517377 7:21503270-21503292 AGCTACAGATCTTCCGGCTATGG - Intronic
1021522326 7:21550427-21550449 AGCTAGACATCTCCCTACTATGG - Intronic
1026615160 7:71895738-71895760 TGCTAGAGATGTACCTACTAAGG + Intronic
1027527652 7:79291035-79291057 GGGTACAGATCTTCTTTCTAAGG - Intronic
1031936166 7:127737725-127737747 GATTTCAGATTTTCCTACTAGGG - Intronic
1032874019 7:136018107-136018129 GGGTACAGACCTTCCTGCTGCGG + Intergenic
1045052350 8:98338622-98338644 GGCTACAAAACTTGCTGCTATGG + Intergenic
1045785418 8:105915715-105915737 AGCCACAGTTCTTCCTACCAGGG + Intergenic
1047561492 8:125991845-125991867 GACTACTGACTTTCCTACTATGG + Intergenic
1047846676 8:128813874-128813896 GGCTACAGATCTTTCACCTGGGG - Intergenic
1056058259 9:82852232-82852254 AGCTACAGAGCTTCATACTATGG - Intergenic
1062199327 9:135293267-135293289 GACTAATGATCTTCTTACTATGG + Intergenic
1193049319 X:77084001-77084023 GACTACTGACCTTCCTACTATGG + Intergenic
1194993671 X:100570992-100571014 AGCTACAGATCTCCCTACTATGG - Intergenic
1195714211 X:107803023-107803045 GTCTACAGATTTACCTACTCTGG - Intergenic
1199965584 X:152817976-152817998 GGCACCAGAGCTTCCTGCTATGG - Intergenic
1202603591 Y:26619301-26619323 CGCTACAGATCCTCCTACCTTGG - Intergenic