ID: 1080315510

View in Genome Browser
Species Human (GRCh38)
Location 11:30943368-30943390
Sequence AGTAGCTACCAGAATAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080315510_1080315512 27 Left 1080315510 11:30943368-30943390 CCCTCTTTATTCTGGTAGCTACT 0: 1
1: 0
2: 0
3: 15
4: 215
Right 1080315512 11:30943418-30943440 ACTTTTAGCTTTGTTCTGTCTGG 0: 1
1: 0
2: 0
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080315510 Original CRISPR AGTAGCTACCAGAATAAAGA GGG (reversed) Intronic
901732604 1:11291113-11291135 ATTAGCGTCCAGAATAAGGAAGG + Intronic
906971548 1:50519777-50519799 AGTATCTTCTAGAAGAAAGAAGG - Intronic
907397917 1:54204985-54205007 ATTAGCCACAAAAATAAAGAAGG - Intronic
908055715 1:60284457-60284479 TATAGCAACTAGAATAAAGAAGG + Intergenic
908348845 1:63264212-63264234 AGTAGCTCCCAGAAATAATAAGG - Intergenic
908500190 1:64735151-64735173 AGCAGACACAAGAATAAAGAGGG + Intergenic
909699671 1:78509138-78509160 AACAGCTACCAGAATACAGGTGG - Intronic
910035892 1:82788151-82788173 AGTATCAACCAAAACAAAGAGGG - Intergenic
910228626 1:84963461-84963483 AGTAGGTATCAGGAAAAAGAAGG + Intronic
910249271 1:85177890-85177912 AGTAGCTAGCAGAAAGAAAAAGG - Intronic
910342654 1:86205562-86205584 AGAAGCTATGAGAACAAAGAGGG + Intergenic
913706535 1:121429886-121429908 TGTAGGTACCAGAAATAAGATGG - Intergenic
913974954 1:143448665-143448687 ATTAGATACCAGAATAAATCAGG + Intergenic
914069346 1:144274282-144274304 ATTAGATACCAGAATAAATCAGG + Intergenic
914109809 1:144692072-144692094 ATTAGATACCAGAATAAATCAGG - Intergenic
915696129 1:157744002-157744024 AGCAGCTATCAGAATACTGAAGG + Intergenic
916209914 1:162352004-162352026 AGCAGCTAGCAGAGTCAAGAGGG - Intronic
916258505 1:162815721-162815743 AATATCTTCCAGAATATAGAAGG - Intergenic
921418588 1:214919821-214919843 AGAAGCCACCAGAATGGAGAAGG - Intergenic
921764966 1:218960680-218960702 AATATCTACAATAATAAAGAAGG - Intergenic
923421196 1:233816956-233816978 AGTAGCTTACAGAGTAAAGGAGG - Intergenic
1065525195 10:26613112-26613134 TGTAGCTCCCAGAATATATAAGG + Intergenic
1066603194 10:37131311-37131333 AATAGAAACCAGAATAAAAATGG + Intronic
1068455060 10:57243769-57243791 AATAACTAATAGAATAAAGAAGG - Intergenic
1068674147 10:59752772-59752794 AGAAGCACCCAGCATAAAGAAGG + Intergenic
1069757007 10:70779584-70779606 AGTACCCACCAGAAGAAAGCTGG + Exonic
1073793954 10:106967761-106967783 AGTAGGTACTAGCTTAAAGAAGG - Intronic
1073866333 10:107808730-107808752 AGTAGTTACCAAAATACAAAGGG - Intergenic
1074610695 10:115018266-115018288 AGTAGCTAGAACAGTAAAGAAGG - Intergenic
1075192518 10:120323404-120323426 AGTAGCTTCCACCATAAAGTTGG + Intergenic
1078784433 11:14474753-14474775 CTTAGCTCCCAGAAGAAAGAAGG + Intronic
1079948693 11:26774704-26774726 AGTAACAGCCAGAATAAAGCAGG + Intergenic
1080315510 11:30943368-30943390 AGTAGCTACCAGAATAAAGAGGG - Intronic
1081235755 11:40645532-40645554 AGTGGCTACTGGAATAAACAGGG - Intronic
1082180296 11:49108961-49108983 AGTGGATGCCAGAATAGAGAAGG + Intergenic
1085537949 11:77236856-77236878 AGTTGCTGCCAGAAGAAAGAAGG + Intronic
1087234984 11:95708060-95708082 AGTGTCTGCCAGAATTAAGAAGG - Intergenic
1087254852 11:95942130-95942152 AATAGCTAGCAGAGTACAGAGGG - Intergenic
1091385263 12:90704-90726 TGAAGCTACCATAATTAAGATGG - Intronic
1093395391 12:18675041-18675063 AGTAGCTACCATATTGAATAAGG - Intergenic
1094240546 12:28218170-28218192 AGTAGCTACCAAAATCAAAAGGG - Intronic
1094757746 12:33492196-33492218 AGTAGAAACCAGAAAAAAGCAGG + Intergenic
1096260304 12:50085889-50085911 AGTAGCTAGCAGAGTAAATGTGG + Intronic
1096592786 12:52672829-52672851 AGTAGCTAAAAGAATTAAAAAGG - Intergenic
1098378012 12:69837904-69837926 AGAGGCTACAAGAATGAAGAAGG - Intronic
1099093736 12:78345482-78345504 AGTAGAAACCAGAAAAGAGAGGG + Intergenic
1099665630 12:85625351-85625373 AGTTCCTACCATGATAAAGAAGG + Intergenic
1100389385 12:94134635-94134657 AGTTTCTACCAGGAAAAAGAGGG + Intergenic
1100854539 12:98747179-98747201 ATTAACAACCAGAATAAATAAGG + Intronic
1102650426 12:114438421-114438443 AGGAGCTCCTAGAACAAAGATGG + Intergenic
1102880690 12:116482452-116482474 AGTAGCGACCTGATTAGAGATGG + Intergenic
1104084678 12:125463432-125463454 AATAGTTACCAGCACAAAGAGGG - Intronic
1105224285 13:18414835-18414857 AATAGAAACCAGAATAAAAATGG + Intronic
1105837968 13:24227041-24227063 AGTAGTTACCAGACTTAGGAAGG + Intronic
1106333887 13:28765187-28765209 AACAGCTAACAGGATAAAGAGGG + Intergenic
1106985418 13:35342176-35342198 AGTACTTACCAGAAGAAAGGAGG + Intronic
1107441525 13:40431861-40431883 AATATCTACCAGTAAAAAGATGG - Intergenic
1108094055 13:46881588-46881610 AGCATCTACCAGAATACAAACGG - Intronic
1110444960 13:75569954-75569976 ACTAGCTAACAGGGTAAAGATGG - Intronic
1111220803 13:85204247-85204269 AGTAGATATCAGAAGACAGAAGG - Intergenic
1112015827 13:95330667-95330689 TGTAGCCACCAGAATAAAATTGG + Intergenic
1116264048 14:42664262-42664284 AGGAGATACCAGAGTAAATAGGG + Intergenic
1118269803 14:64332370-64332392 AGTAAATAACAGAATAAAGATGG + Intronic
1118284172 14:64456055-64456077 AGCAGCTACCAGCTGAAAGACGG + Intronic
1120312782 14:82852205-82852227 AGTAGCTAAATAAATAAAGAGGG + Intergenic
1121521982 14:94592303-94592325 ACTAGCTACCAGCATACAGATGG - Exonic
1124169224 15:27358078-27358100 AGAAGCTACCAGACTCATGAAGG + Intronic
1127612509 15:60650750-60650772 ATTAACTTCCAGAATAAAGGAGG + Intronic
1127697677 15:61467769-61467791 AGTAGATACCAAAATGTAGATGG + Intergenic
1128036059 15:64527833-64527855 AGTGGCAACAAGTATAAAGAGGG - Intronic
1129642913 15:77399926-77399948 ATTAACAACCAGAATATAGAAGG + Intronic
1135510828 16:23081550-23081572 AGAGGCTACAAGAATGAAGATGG - Intronic
1145084545 17:19925787-19925809 AAGAGGGACCAGAATAAAGAGGG + Intronic
1146059980 17:29599670-29599692 AGTCACTTCCAGAATGAAGAAGG + Intronic
1149017965 17:51930925-51930947 ATTAGCTTTCAGAATCAAGATGG + Intronic
1151271604 17:73000583-73000605 AGTAGCTCCCAGAATGTTGATGG - Intronic
1152219990 17:79058405-79058427 GCCATCTACCAGAATAAAGAAGG + Intergenic
1152993638 18:385846-385868 ACTGGTTACCAGAACAAAGAGGG + Intronic
1154290489 18:13102153-13102175 AGGAGCTCCCAGAGGAAAGAAGG - Intronic
1154475639 18:14753947-14753969 AATAGCAACCAGAATAAAAATGG + Intronic
1154529073 18:15324604-15324626 AATAGAAACCAGAATAAAAATGG - Intergenic
1156448914 18:37255488-37255510 TATAGATACCAGAATAAATAGGG + Intronic
1156877972 18:42039249-42039271 AGTAACTACTAGTATAAAGCAGG - Intronic
1158587406 18:58753377-58753399 AGTATCTACTAAAATAAACAGGG + Intergenic
1159394541 18:67838827-67838849 AGTGGAGACCAGAATAAAGGGGG - Intergenic
1163591675 19:18197326-18197348 AATAGCTACAATAATAAATAAGG + Exonic
1164010211 19:21196224-21196246 TGTAGATATCAGAATAAAAATGG + Intergenic
926171632 2:10556393-10556415 AGGAGCTCCCAGTCTAAAGAGGG - Intergenic
926332361 2:11836028-11836050 AGTAAATTCCAGAATAAACAGGG - Intergenic
926393330 2:12416689-12416711 CTTAGATACCAGAATAAACATGG + Intergenic
926424533 2:12728914-12728936 AGTATCTAACAGAGTACAGAGGG + Intronic
927408770 2:22801255-22801277 AGCAGCTACCAAAACCAAGATGG - Intergenic
928288694 2:30018043-30018065 AGCAGTTACCAGAATCCAGAAGG + Intergenic
930532413 2:52606498-52606520 ATTAGTAACCAGAATATAGAAGG - Intergenic
932188119 2:69715846-69715868 AGCAGCTGCCAGATAAAAGAGGG - Intronic
933452000 2:82466569-82466591 AGTTGCTAGCAGAGAAAAGATGG + Intergenic
933855102 2:86405595-86405617 AGTAGCAACCACAAGAAAGCTGG + Intergenic
934179658 2:89609644-89609666 ATTAGATACCAGAATAAATCAGG + Intergenic
934289948 2:91683903-91683925 ATTAGATACCAGAATAAATCAGG + Intergenic
934737179 2:96695491-96695513 AGGATCTACCAGAACAAAGAAGG - Intergenic
935157710 2:100497733-100497755 AGTGGGTACCAGAATGAAGCGGG - Intergenic
935519106 2:104082067-104082089 GGTAGGTACCATGATAAAGAGGG - Intergenic
935679568 2:105624270-105624292 AGAAGATACCAACATAAAGATGG - Intergenic
936510793 2:113144197-113144219 AATAGCTAGAAGAATAAAAAAGG - Intergenic
936960586 2:118069749-118069771 AGTAGCTACAATAAATAAGAAGG - Intergenic
937801457 2:126085261-126085283 AGAAGTTACCAGAATGAGGATGG - Intergenic
939185099 2:138851405-138851427 AGTAGCTGTGAAAATAAAGAAGG - Intergenic
940927042 2:159375638-159375660 ACTAGCTAACAGATTAGAGAAGG + Intronic
941523884 2:166582242-166582264 GGTAGCTAAAACAATAAAGATGG + Intergenic
941929682 2:170927492-170927514 AGCAGCTTCCATCATAAAGAGGG + Intergenic
942254463 2:174081810-174081832 AGTAATTACCATTATAAAGAGGG - Intronic
942914003 2:181280471-181280493 AGTAGATACCAGATTTAAAATGG + Intergenic
946638325 2:221755220-221755242 AGCAGCTACCAGAACCTAGAAGG - Intergenic
1169838682 20:9909757-9909779 AGTATATACAGGAATAAAGAAGG - Intergenic
1170769873 20:19323242-19323264 AATAGCTTGAAGAATAAAGAAGG - Intronic
1172325564 20:34031849-34031871 AGCAGCTAGCAGAAGCAAGAAGG - Intronic
1175611158 20:60352365-60352387 AGTGGCCACCAGAATAAAGGGGG + Intergenic
1175659735 20:60802381-60802403 CGAAGCTTCCAGAATGAAGAGGG - Intergenic
1176768326 21:13043892-13043914 AATAGAAACCAGAATAAAAATGG + Intergenic
1177771857 21:25525886-25525908 AGTAGCTACGAGAAACAAGAAGG - Intergenic
1179166864 21:38942092-38942114 AGTAGCCACCCGAGTCAAGATGG - Intergenic
1180515455 22:16138085-16138107 AATAGAAACCAGAATAAAAATGG + Intergenic
1185310267 22:50150421-50150443 AGAAGCTTCCAGAAGATAGACGG + Intronic
949275193 3:2271049-2271071 AGTAGCAGGCAGAATATAGATGG + Intronic
949666964 3:6350264-6350286 AGTGGCTGCCACAATTAAGATGG - Intergenic
949847748 3:8389239-8389261 AGTAGGTCCCAGAACACAGAAGG + Intergenic
951882828 3:27496218-27496240 AATACCTGGCAGAATAAAGAGGG + Intergenic
952165509 3:30744341-30744363 AGTATCTACCATCATAAAGGTGG + Intronic
952753563 3:36845911-36845933 AGTATCTATCAAAATAAAGATGG - Intronic
953118512 3:40016164-40016186 AGTAGTCACCAGCATAGAGATGG - Intronic
953779565 3:45854863-45854885 AGTAGCTCTTAGCATAAAGAAGG - Intronic
954864454 3:53717244-53717266 AGGAGGTTCCAGAGTAAAGAAGG - Intronic
955309538 3:57871911-57871933 AATAGCTACCATAAAAAAGAGGG + Intronic
955802728 3:62702691-62702713 AGTAGCTGTCATAATGAAGAAGG - Intronic
959848376 3:111059917-111059939 ACTAGCCAAAAGAATAAAGAAGG + Intergenic
960229654 3:115210204-115210226 AGTGGCCATCAAAATAAAGAGGG - Intergenic
963631643 3:147738892-147738914 AGTAACTACCAGACTACAGAGGG - Intergenic
963810556 3:149772494-149772516 AGCAGAGACCTGAATAAAGAAGG - Intronic
964173469 3:153797809-153797831 AGTAGATAAAACAATAAAGATGG + Intergenic
965191339 3:165532887-165532909 AGTTGCTACCATATTAAATAGGG - Intergenic
965215079 3:165853103-165853125 AGAAGCTACAACAATCAAGATGG - Intergenic
968267504 3:197373683-197373705 AGGAGCTACCAGTCTAAAGGAGG - Intergenic
969877116 4:10143905-10143927 AGCAGCTACTAGCACAAAGATGG - Intergenic
970121811 4:12762380-12762402 AGTAGCTACCTGAAATGAGATGG - Intergenic
971168727 4:24211416-24211438 AGGAGCTGCCAGGATACAGAAGG + Intergenic
972905345 4:43739492-43739514 AGTAGAAACTAGTATAAAGATGG - Intergenic
973539970 4:51925967-51925989 ATCAGCTGCCAGAATAAAGCAGG - Intergenic
973934271 4:55827301-55827323 AGAAGTTAGCAGAATGAAGATGG - Intergenic
976097636 4:81526615-81526637 AGGAGCTAGCAGAAAACAGAGGG + Intronic
977292582 4:95179875-95179897 ATTAGCTCCCAGAGAAAAGAAGG - Intronic
977329220 4:95616150-95616172 AATAGCTAACATAATAAAAAAGG + Intergenic
979803055 4:124935980-124936002 AGTAGCAACCAGAAGACAGGAGG - Intergenic
980265840 4:130514662-130514684 AATAGATACCTGAACAAAGATGG - Intergenic
981121612 4:141057725-141057747 AGCAGATACCAGAATACAGGGGG - Intronic
981182288 4:141759929-141759951 AGTCACAACCAGAACAAAGAAGG - Intergenic
983002751 4:162438786-162438808 AGAAACTAACAGAATAAACAAGG + Intergenic
983479866 4:168260018-168260040 AGTAGCAAACTAAATAAAGAAGG + Intronic
986920923 5:12679137-12679159 ACTATCTAACATAATAAAGATGG + Intergenic
987189114 5:15455484-15455506 AGTAATAACCAGAATAAATAAGG - Intergenic
989757276 5:44970657-44970679 ATTAACTACCAGAATATACAAGG + Intergenic
989971133 5:50526046-50526068 TGTAGGTACCAGAAATAAGATGG + Intergenic
990338325 5:54796788-54796810 AGTATCTACCAGAACTATGATGG - Intergenic
990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG + Intergenic
992334612 5:75753065-75753087 AGTAGCTGCGAAAATCAAGAGGG + Intergenic
996144479 5:119956965-119956987 AGAAGCTAGAAGAATAAAAACGG + Intergenic
996686426 5:126286498-126286520 AATATCTACCAGAAAATAGAAGG + Intergenic
996966699 5:129314706-129314728 AGTGGCTATCAGAACAATGATGG + Intergenic
998877624 5:146616487-146616509 ATTAATTACCAGAATATAGAAGG + Intronic
1000125512 5:158239750-158239772 ATTAGCTCCCAGAAAAAATAGGG - Intergenic
1002486429 5:179540810-179540832 AAGAGTTACGAGAATAAAGATGG - Intergenic
1003316349 6:5015697-5015719 AGTAGGTACCACAAATAAGACGG - Intergenic
1003766971 6:9248716-9248738 AATATCTACCAGAATAGAAAAGG - Intergenic
1004123548 6:12850229-12850251 AGAAGCCACCAGAATAACAATGG + Intronic
1005438835 6:25843226-25843248 AGAAGCTAAAAGAATAAAAAAGG + Intronic
1007643127 6:43358904-43358926 AGGAGCTACCAAAAGAAAGGAGG + Intronic
1008679356 6:53856032-53856054 AGTTGCTAGCACAGTAAAGAAGG - Intronic
1010065807 6:71681213-71681235 AGTGGTAACCAGGATAAAGATGG - Intergenic
1010098030 6:72069661-72069683 AGGAGCATCAAGAATAAAGAAGG - Intronic
1011957733 6:93044206-93044228 ACAAGCTAGAAGAATAAAGATGG - Intergenic
1011957842 6:93045394-93045416 AGCTGCTAAAAGAATAAAGATGG - Intergenic
1013897425 6:115106697-115106719 AGTAAATACCATAATAAAGTGGG + Intergenic
1016679009 6:146806482-146806504 TGTAGCTACCATAATAAAACTGG - Intronic
1016679652 6:146814091-146814113 TGTAGCTACCATAATAAAACTGG - Intronic
1017465687 6:154691695-154691717 AGTAGTTGCCAGAATTAATATGG + Intergenic
1017541572 6:155408323-155408345 GGTAGCTACCAGAATGCAGAAGG - Intronic
1018058085 6:160069499-160069521 GGTAGCTTCTTGAATAAAGAAGG + Intronic
1019879598 7:3846852-3846874 AGCAGCAGCCAGACTAAAGAGGG - Intronic
1020372923 7:7454000-7454022 AGTAGATACCAAACTGAAGAAGG + Intronic
1020709599 7:11590459-11590481 AGTACCCACAAGAACAAAGAAGG - Exonic
1022527871 7:31049987-31050009 AGTGGCTTCCAGAATTAAGGGGG + Intergenic
1027502537 7:78971145-78971167 AGGAGCTACAAGATAAAAGAGGG - Intronic
1027700033 7:81458529-81458551 AGTAGCTAAAAGAATGAAGAAGG + Intergenic
1028620229 7:92817763-92817785 AGAAGCTACCAGACTAATAAGGG + Intronic
1030436340 7:109526079-109526101 AGTGGCTACCTTAATAGAGAAGG + Intergenic
1030444301 7:109629790-109629812 TGTAGGGATCAGAATAAAGATGG - Intergenic
1033007855 7:137586932-137586954 AGAAGCTACCAGATCAAATAAGG + Intronic
1036709630 8:11069667-11069689 ATAAGCAAACAGAATAAAGAGGG + Intronic
1036712308 8:11088069-11088091 AGTAGCTTCAAGAATTCAGATGG + Intronic
1038353801 8:26807312-26807334 AGAAGGTACAAGAATCAAGAAGG + Intronic
1041374337 8:57197558-57197580 AATAGATACCAGAATAAAAATGG + Intergenic
1041920206 8:63173752-63173774 ACTAGAAACCAAAATAAAGAGGG - Intronic
1041970681 8:63738739-63738761 AGTACTTACCAGTTTAAAGAAGG - Intergenic
1042043451 8:64621265-64621287 AGAAGCTAACAGAATAATGAAGG + Intronic
1043002177 8:74772276-74772298 AATATCTAACATAATAAAGAAGG - Intronic
1043112136 8:76199716-76199738 AGCAACTACCATAATGAAGATGG + Intergenic
1044700370 8:94960154-94960176 AGCTGCTACCAAAAAAAAGAAGG - Intronic
1046387185 8:113520149-113520171 AGGAGGTACCAGAGTAAACAGGG - Intergenic
1048832649 8:138491808-138491830 AGTTGCAGCCAGAATAAAGTAGG + Intronic
1050172065 9:2830494-2830516 ATTAGCCACCAGTATTAAGAGGG - Intronic
1050278931 9:4030326-4030348 ATTAACTACCAGAATATATAAGG - Intronic
1050775237 9:9251470-9251492 AGTAGTTTTCAAAATAAAGAAGG - Intronic
1052228695 9:26120954-26120976 GGAAGTTACCAGAATATAGATGG + Intergenic
1053706793 9:40762343-40762365 AATAGAAACCAGAATAAAAATGG - Intergenic
1054416707 9:64883109-64883131 AATAGAAACCAGAATAAAAATGG - Intergenic
1055945048 9:81686389-81686411 AGTAGCTACTGCAATAAAGTGGG + Intronic
1057831041 9:98407312-98407334 TGCAGCTTCCAGAATAAAGGGGG + Intronic
1062465675 9:136679990-136680012 AATAGCCACCAGTAGAAAGAGGG + Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1188268310 X:28106330-28106352 GGTAGCTCCCAGATTAAATAAGG + Intergenic
1188520549 X:31033368-31033390 TCCAGCTACCAGAAGAAAGATGG + Intergenic
1191779516 X:64850444-64850466 AAAAGCTAACAGAAGAAAGATGG - Intergenic
1191859963 X:65658106-65658128 AGTAGCTACAAGACTGAGGATGG + Intronic
1193306138 X:79954559-79954581 ATTAATTACCAGAATATAGAAGG + Intergenic
1195136905 X:101917298-101917320 ATTAGTAACCAGAATATAGAAGG + Intronic
1196304124 X:114080875-114080897 AGTAGAATCCAAAATAAAGAAGG - Intergenic
1198144532 X:133841782-133841804 TGTGCCTACCAGATTAAAGACGG - Intronic
1199410332 X:147514659-147514681 GGTGGCTACCAGGAAAAAGAAGG + Intergenic
1200229280 X:154436175-154436197 TGTAGCCACAAGAATAAATAAGG - Exonic
1201647323 Y:16249722-16249744 ACTAGCTACACAAATAAAGAAGG + Intergenic
1201655488 Y:16335579-16335601 ACTAGCTACACAAATAAAGAAGG - Intergenic
1202016446 Y:20411758-20411780 AATAGCCACAAGAAGAAAGAAGG + Intergenic