ID: 1080317143

View in Genome Browser
Species Human (GRCh38)
Location 11:30963048-30963070
Sequence TTGGTATCTCAGATATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080317139_1080317143 6 Left 1080317139 11:30963019-30963041 CCTATCTGGGCTTGATAGGTAGG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1080317143 11:30963048-30963070 TTGGTATCTCAGATATTTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080317143 Original CRISPR TTGGTATCTCAGATATTTGG TGG Intronic
900857377 1:5196872-5196894 TGGCTTTCCCAGATATTTGGCGG + Intergenic
901941205 1:12663294-12663316 TTGATTTCTCAGAGTTTTGGAGG + Intronic
903906655 1:26692803-26692825 TTTGTATTTCAGACATTTAGGGG + Intergenic
903998442 1:27322851-27322873 TTGGACTCTCAGATCTCTGGGGG - Intronic
904879242 1:33682372-33682394 TTGGAACCTCACATTTTTGGGGG + Intronic
907887460 1:58606684-58606706 TTGGTTTCTCAGGTAATGGGTGG + Intergenic
910242152 1:85098985-85099007 TTATGATCTCAGATATCTGGGGG + Intronic
911341080 1:96638363-96638385 TCTGTATCTGAGACATTTGGGGG - Intergenic
911397319 1:97327042-97327064 TTGGTGTCTCAGACAGTTGCTGG - Intronic
911646437 1:100342099-100342121 TTGTAATCCCAGATACTTGGAGG - Intergenic
912827701 1:112921263-112921285 TTGGAATCTCTGATATATTGTGG + Intronic
913551733 1:119923185-119923207 TTGGTATCTCAGCTAGCTGGAGG + Intronic
917000107 1:170348234-170348256 TTGGTCTCTCAGGCATTAGGTGG - Intergenic
917367320 1:174246727-174246749 TTGGTATCTGGGAGTTTTGGGGG + Intronic
921624941 1:217369681-217369703 TTGGTGTGTCAGAGATTTGCCGG + Intergenic
1064848356 10:19681991-19682013 TTGGTATCCCAGAAATTAGCTGG - Intronic
1064895112 10:20226924-20226946 TTGGAATCTGAGATATATGAGGG + Intronic
1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG + Intronic
1067675045 10:48366990-48367012 TTGGTACTTCAGATATTTCTTGG - Intronic
1068009360 10:51428495-51428517 TTGTTTTATCAAATATTTGGAGG - Intronic
1068030938 10:51704020-51704042 TTCTAATCTCAGCTATTTGGAGG + Intronic
1068251143 10:54442271-54442293 TTGGGATCTCAGAAATCTTGGGG + Intronic
1068299830 10:55124317-55124339 TTGATATGTCAGCTATTTGCTGG + Intronic
1068597092 10:58914249-58914271 TTTGGATCACTGATATTTGGTGG - Intergenic
1069420833 10:68245020-68245042 CTGTTTTCTCAGATATTTTGGGG + Intergenic
1071104749 10:82081226-82081248 TTGGAATGTCAGATCTTGGGAGG - Intronic
1071269182 10:83991286-83991308 CTGTTATCTCAGCTACTTGGGGG + Intergenic
1074057291 10:109933999-109934021 TTGGCAACTCAGATCTTTGCAGG + Intergenic
1076241919 10:128915252-128915274 TTTGTAGCTCAGCTGTTTGGGGG + Intergenic
1078630585 11:13000269-13000291 TTAGAATCTCATATTTTTGGTGG - Intergenic
1079613741 11:22465080-22465102 TTGATATCTAAGAAAGTTGGTGG - Intergenic
1080317143 11:30963048-30963070 TTGGTATCTCAGATATTTGGTGG + Intronic
1082198449 11:49332343-49332365 TTGGTAGCTCAGATCTCTGTTGG + Intergenic
1084144774 11:67259205-67259227 TGGGTTTCTGAGATATTTAGGGG - Intergenic
1084672913 11:70618038-70618060 TTGGAATCTCAGCACTTTGGGGG + Intronic
1084993371 11:72950756-72950778 TTGGCTTCTCAGATATTTAGAGG + Intronic
1086059657 11:82687675-82687697 TTGGTCTTGCAGATATCTGGGGG + Intergenic
1086657357 11:89375772-89375794 TTGGTAGCTCAGATCTCTGTTGG - Intronic
1087377285 11:97360274-97360296 TAGGTATGTCAGATATTTAATGG + Intergenic
1090070153 11:123536958-123536980 TTGGTCTCTCAGACCTTCGGGGG + Intronic
1091632741 12:2174161-2174183 GTGGTATCCCAGATAAATGGTGG + Intronic
1092226604 12:6752373-6752395 ATGGAAGCTCAGATACTTGGAGG + Intronic
1093659935 12:21744856-21744878 TTTGTATCTCAGCTATTAGTTGG + Intronic
1093701326 12:22225174-22225196 TTGTTTTCTCAGAATTTTGGAGG - Intronic
1093843869 12:23943195-23943217 TGGGTATCTCTGATATTCTGTGG - Intronic
1094763851 12:33568578-33568600 TTGGTATCTGTGATATATGTAGG + Intergenic
1095553115 12:43468217-43468239 TTGGTATTACAAATATTTGGGGG + Intronic
1095723088 12:45422694-45422716 TTGTAATCGCAGCTATTTGGTGG - Intronic
1096860707 12:54525858-54525880 GTGAAATCTCAGATACTTGGGGG + Intronic
1098281806 12:68869679-68869701 TTTGTATCTGACTTATTTGGGGG - Intronic
1098321385 12:69247473-69247495 TTGGTATCAAAGATAATTAGAGG + Intronic
1098540677 12:71653060-71653082 TCAGTATCTCAGGTCTTTGGGGG - Intronic
1099185305 12:79509954-79509976 TTGTAATCTCAGCTACTTGGGGG + Intergenic
1099729372 12:86478972-86478994 TTGAAATCTCACATATTTGAAGG + Intronic
1100008642 12:89925351-89925373 TTGATATCTGAGAAAGTTGGAGG - Intergenic
1102192303 12:110997984-110998006 TTGGTGTTTCAGATATTTTTCGG + Intergenic
1103148155 12:118613177-118613199 TTGATAACTCCAATATTTGGAGG - Intergenic
1104204204 12:126620861-126620883 TTGTCTTCTCAGTTATTTGGAGG + Intergenic
1105752632 13:23435389-23435411 CTGTAATCTCAGATACTTGGAGG + Intergenic
1106992906 13:35444750-35444772 TTAGTATCTTGGATATTTGAAGG - Intronic
1107349384 13:39498655-39498677 TTGTTAAATTAGATATTTGGGGG - Intronic
1107582368 13:41804230-41804252 TAGGTACCTCAGATATCTTGAGG - Intronic
1108386669 13:49905317-49905339 TTTGTATCTCACATGTCTGGAGG - Intergenic
1110117976 13:71843728-71843750 TTGGTATATAATATATTTGAAGG - Intronic
1111359219 13:87152870-87152892 TTTGTATCACAGATATCTGGAGG + Intergenic
1111486894 13:88914290-88914312 TAGGTATTTGAGATATTTTGTGG - Intergenic
1113744088 13:112730735-112730757 TTAGGCTTTCAGATATTTGGGGG + Intronic
1114470174 14:22955589-22955611 TTGATAGCTGAGTTATTTGGGGG - Intronic
1114694309 14:24612442-24612464 TTGGTTTCTCAGATGATGGGTGG + Intergenic
1114867958 14:26620886-26620908 TTGTTATCTCACAGATTTTGTGG - Intergenic
1114911241 14:27200451-27200473 TAGATACCTCAAATATTTGGGGG - Intergenic
1117480186 14:56135483-56135505 ATGGTAGCTCAGAGATTTTGAGG + Intronic
1117589429 14:57251289-57251311 CAGGGATCTCAGATATTTGGAGG - Intronic
1118053462 14:62054278-62054300 TCTGTAGATCAGATATTTGGTGG - Intronic
1119443186 14:74642755-74642777 TTTGTATCCCAGATGCTTGGTGG + Intergenic
1120475309 14:84979365-84979387 TAAATATCTGAGATATTTGGGGG - Intergenic
1121439542 14:93940072-93940094 TTGCCAGCTCAGTTATTTGGAGG + Intronic
1121647706 14:95531441-95531463 AAGCTATCTCAGATATGTGGAGG + Intergenic
1121938256 14:98041511-98041533 TTGGGATCTGAGACATTTGCTGG - Intergenic
1122121948 14:99559275-99559297 TTGTTCTCTCACATTTTTGGAGG - Intronic
1124691899 15:31830329-31830351 TTGGTATTGCAGATATTCAGAGG - Intronic
1125965256 15:43869781-43869803 TGGGTACCTCTGAAATTTGGAGG + Intergenic
1126279711 15:46930761-46930783 TTGGTACCTCACTTATTTTGGGG + Intergenic
1126795546 15:52257977-52257999 TTGGTGGCTCAGAGATTCGGAGG + Intronic
1127599174 15:60518119-60518141 TTGGAATCCCAGCTACTTGGGGG - Intronic
1127879640 15:63145431-63145453 TTTGTGTTTCAGAAATTTGGGGG + Intronic
1133753806 16:8746216-8746238 TGAGTATCTCAGATCTCTGGTGG - Intronic
1134350660 16:13434806-13434828 TTGGTATTTCAGGTTTTTAGTGG + Intergenic
1134664003 16:16005169-16005191 TTGGAATCAGAGCTATTTGGAGG + Intronic
1134780356 16:16889702-16889724 TTCGTATCTCATATTTCTGGAGG + Intergenic
1137832835 16:51560540-51560562 TTGGAGTCTCATATATTTGCGGG - Intergenic
1138045667 16:53721937-53721959 TTCATATCTCAGATAATTGATGG + Intronic
1138217413 16:55216526-55216548 TTGTAATCTCAGCTCTTTGGAGG - Intergenic
1140024673 16:71275000-71275022 TTATTATCTCACATTTTTGGTGG - Intergenic
1140034119 16:71359854-71359876 CTGGCATCTCAGACATTTTGTGG + Intronic
1140536253 16:75712770-75712792 TGGGTATTTCAGATGTTTGTTGG + Intronic
1140833033 16:78769121-78769143 TTGGTATTCCAAATAATTGGTGG + Intronic
1143311344 17:5992197-5992219 TTGGTATTTCATTTATTTGCTGG + Intronic
1144055410 17:11536389-11536411 TTTGTATTTGGGATATTTGGGGG + Intronic
1146198417 17:30832608-30832630 TTGGATTCTGAGATATTTGCGGG + Intronic
1146199602 17:30845215-30845237 TTGGTATCAGAGATATTATGGGG + Intronic
1150162549 17:62911069-62911091 TAGGTATCTCAGATAGAAGGAGG + Intergenic
1151661747 17:75522603-75522625 TTGGGATCACAGCTAGTTGGTGG - Intronic
1153434621 18:5056211-5056233 TAGGTATCTAAGATGTCTGGGGG + Intergenic
1154094649 18:11401160-11401182 ATCGTATCTCAGTTCTTTGGAGG - Intergenic
1158466313 18:57693361-57693383 CTGGTAACTTAGATGTTTGGAGG + Intronic
1158820573 18:61154063-61154085 TTTTTTTCTCAGATATTTTGAGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161083671 19:2323969-2323991 TTGGTAACTCAGAGGTTTTGTGG + Intronic
1163355592 19:16808425-16808447 TTGTAATCTCAGCTACTTGGGGG + Intronic
1164463276 19:28466351-28466373 TTGGTTTCTGAAATATTTGGCGG - Intergenic
1165556619 19:36638325-36638347 TGGTTATCTCAGAGATTTGAGGG + Exonic
1166639033 19:44478685-44478707 TTGGAATCACAGAAATTTGTGGG - Intronic
1167818027 19:51901316-51901338 TTGGGAGCTTAGATTTTTGGAGG - Intronic
1168689931 19:58370132-58370154 TTGTTATCTCAGAGTTCTGGAGG + Intronic
927002366 2:18811457-18811479 CTGGCATCTTAGATATTAGGGGG + Intergenic
927263049 2:21113735-21113757 TTGCTCTCTCATGTATTTGGGGG - Intergenic
928568062 2:32574125-32574147 TTGGATTCTCAAATATGTGGGGG - Intronic
929809529 2:45178074-45178096 TTGGTATTTCAGTCATTTCGTGG - Intergenic
930014392 2:46960385-46960407 CTGGTATACCTGATATTTGGTGG + Intronic
930822127 2:55657345-55657367 CTGGAATTACAGATATTTGGGGG - Intronic
931177322 2:59867223-59867245 TTGATTTCTCACACATTTGGAGG + Intergenic
931195530 2:60049050-60049072 TAGGGATTTCAGATATATGGAGG + Intergenic
932628678 2:73319705-73319727 TAGGCATCCCAGATATATGGTGG + Intergenic
933264904 2:80171504-80171526 TTGGGTTGTCACATATTTGGGGG - Intronic
938819843 2:134945877-134945899 CTTGTTTCTCAGATCTTTGGGGG + Intronic
939118117 2:138084855-138084877 CTGTTATCTCATATATTTTGAGG - Intergenic
939571843 2:143848947-143848969 ATGAAATCTCAGATTTTTGGGGG - Intergenic
940446191 2:153780714-153780736 TGGGCATATCATATATTTGGGGG - Intergenic
941014353 2:160337749-160337771 TTGGTATCTCAGACAAGTAGAGG - Intronic
942453815 2:176124333-176124355 TTGGTCTCTGAGGTATTTGGGGG + Exonic
942599022 2:177621136-177621158 TAGGGATCCCAGAAATTTGGAGG - Intergenic
943458467 2:188138466-188138488 ATCATATCTCATATATTTGGAGG - Intergenic
945319188 2:208401986-208402008 TTTGTATCACAGCCATTTGGTGG + Intronic
945425736 2:209698250-209698272 TTGGCATTACAGATATTTGTAGG - Intronic
946583295 2:221154507-221154529 TTGATATTTCAGATGTTTCGGGG - Intergenic
947113825 2:226748102-226748124 TTGGACTCTCAGAGATTTGAGGG - Intronic
947353047 2:229266430-229266452 TTGGTGGCTCAAATCTTTGGTGG - Intronic
947373134 2:229468629-229468651 TCAGTATCTCTGATATTTCGGGG - Intronic
1169534105 20:6518453-6518475 TTAGTATGCCAGATATTTGGTGG - Intergenic
1171162387 20:22939779-22939801 TTGGTGTATCTGATATTTTGTGG + Intergenic
1172288176 20:33756098-33756120 CTGTTATCCCAGCTATTTGGTGG + Intronic
1174851962 20:54004326-54004348 TTGATATCTCACAGTTTTGGAGG - Intronic
1176674332 21:9763679-9763701 TTGGTTTCTCAGTTATGTGGAGG + Intergenic
1177330511 21:19654472-19654494 TTGGTTTTTAAGATATTTTGTGG + Intergenic
1177939860 21:27396443-27396465 TAGTTATTTTAGATATTTGGAGG + Intergenic
1178632535 21:34275002-34275024 TTACTATTTCACATATTTGGGGG + Intergenic
1182017950 22:27056487-27056509 TTGGCATCTGAGATATATGGAGG - Intergenic
1182182012 22:28359546-28359568 TTAGTATCTAACACATTTGGAGG + Intronic
1182284738 22:29238949-29238971 TTGGTGTCTGACATTTTTGGGGG + Intronic
1182501279 22:30749728-30749750 CTGTAATCTCAGATACTTGGAGG - Intronic
1183526968 22:38328827-38328849 TAGGAACCTCGGATATTTGGGGG + Intronic
1184541220 22:45126594-45126616 TTGGTTTCTCAGAGTTCTGGAGG + Intergenic
949874810 3:8619231-8619253 TGGTTCACTCAGATATTTGGTGG - Intergenic
949955935 3:9268665-9268687 TTGTTATCTCAGAGTTTTTGTGG - Intronic
950341117 3:12245572-12245594 TTGCCCTCTCTGATATTTGGTGG - Intergenic
951961994 3:28336214-28336236 TTGAATTCTCAGATATTTGCTGG + Intronic
957234888 3:77574240-77574262 TTGGTATCTTAGATACTGTGAGG + Intronic
957720161 3:83985034-83985056 TTGGTATATAAGTTAATTGGTGG + Intergenic
957813423 3:85258169-85258191 TGATTATCTCAGATATTTAGAGG + Intronic
958749958 3:98183737-98183759 TTGTAATCACAGATACTTGGGGG + Intronic
959079834 3:101788578-101788600 TTGGTATCTTAGTTATTTTTAGG + Intronic
959143938 3:102521695-102521717 TTGGTGTCTCAGATAGTTTGGGG + Intergenic
961938972 3:130617582-130617604 TTGACATCTCAGATGTTTTGGGG + Intronic
962557757 3:136572917-136572939 TTGTAATCTCAGAGCTTTGGAGG + Intronic
965094422 3:164206233-164206255 TTGGTATCTTAGATATTCTTTGG - Intergenic
965994604 3:174864800-174864822 TTTGTATCACAGTTTTTTGGGGG + Intronic
967567873 3:190992630-190992652 TTGGTTTCTCAAATATTTTTAGG - Intergenic
970112735 4:12656976-12656998 TTAGTATCTCACAATTTTGGAGG - Intergenic
970169597 4:13276572-13276594 TTTGTACCTCAGAGATTTTGTGG - Intergenic
972044485 4:34647475-34647497 GTGGAATGTCAGATATTTGGTGG + Intergenic
972105489 4:35480298-35480320 TTGGTGTCTCAGACAATTGGTGG + Intergenic
974078579 4:57190409-57190431 TTGGAAGATCAGATATTTGATGG + Intergenic
977306068 4:95324850-95324872 TTTATGTCTCAGAGATTTGGAGG - Intronic
979506651 4:121504965-121504987 TTTGTATCACTGATATTTGAGGG + Intergenic
984526600 4:180866108-180866130 CTGGTGTCTCTGACATTTGGGGG - Intergenic
984617071 4:181910732-181910754 TTGGAATCTCAGCACTTTGGGGG - Intergenic
984663636 4:182401758-182401780 TTTGTTTCTCTGATATTTTGAGG + Intronic
984687934 4:182692438-182692460 TTTGTATCCCAGAGAATTGGAGG + Intronic
985191134 4:187374151-187374173 TTGGCATCTCAGTTATTTCCAGG + Intergenic
986173339 5:5331521-5331543 CTGGCATCTCAGAATTTTGGAGG - Intergenic
987810787 5:22832798-22832820 TTTGTATCAAAGATATTTGTTGG - Intronic
989073507 5:37537119-37537141 TTAGTTTCTCAGATATTTTTTGG + Intronic
992457513 5:76929385-76929407 TTTGTCTCTCAGATATATGCAGG + Intergenic
997782369 5:136673044-136673066 TTTGCATCTCACTTATTTGGGGG - Intergenic
998947739 5:147359219-147359241 CTGGTTTCTCAGCTATTTGAGGG + Intronic
1001061387 5:168492553-168492575 TTGGTTCTTAAGATATTTGGAGG + Intronic
1002564974 5:180106936-180106958 TTTGTAGCTCTGATGTTTGGTGG + Intronic
1003230630 6:4249751-4249773 TTGGAGTCTCAGCTTTTTGGGGG + Intergenic
1004933351 6:20483303-20483325 TTGGCTTCCCAGATTTTTGGTGG + Intronic
1008442188 6:51544336-51544358 TTGTCATCTTAGGTATTTGGTGG - Intergenic
1010937636 6:81880746-81880768 CTGGTACCTCATCTATTTGGTGG + Intergenic
1011205342 6:84888675-84888697 TTGGAATGCCAGATATTTGTTGG + Intergenic
1011518822 6:88182066-88182088 TTAGTTTCCCAGAAATTTGGAGG + Intergenic
1012167291 6:95973126-95973148 TTGGTATTTGGGATATTTTGTGG - Intergenic
1012974544 6:105766074-105766096 GTGGTATCACAGATATTTACAGG - Intergenic
1013864719 6:114681615-114681637 TTACTATCTCAAATTTTTGGAGG + Intergenic
1014216408 6:118756327-118756349 TTGGCACCTCACATAATTGGAGG - Intergenic
1014411730 6:121131702-121131724 TTTGTTTATCAGATATTTTGAGG + Exonic
1015682423 6:135823270-135823292 TTGGTAACTCTGACATTTAGTGG + Intergenic
1015768819 6:136747955-136747977 TAGGTCTATCAGATATATGGTGG + Intronic
1020208617 7:6140156-6140178 CTTGTTTGTCAGATATTTGGAGG + Exonic
1020366398 7:7385200-7385222 TTGTTTTCTCAGATTTTTTGTGG + Intronic
1021214235 7:17896541-17896563 TTGAGACCCCAGATATTTGGAGG - Intronic
1021289839 7:18829493-18829515 TTGGTCTCTCAAGTATTTGGCGG - Exonic
1021674344 7:23065131-23065153 CTGCTATCTCAGAGTTTTGGCGG - Intergenic
1023706560 7:42947414-42947436 TGGGTATCTCACAAATTTGTGGG + Intronic
1026966701 7:74444708-74444730 TTGTAATCTCAGCTACTTGGGGG - Intergenic
1027675315 7:81150401-81150423 TTGGGATCACAGATATGTTGAGG + Intergenic
1028694650 7:93694545-93694567 TTGAGATCTCTGATATTTAGAGG - Intronic
1030830733 7:114217596-114217618 TTGATATGTCAGATATTTTATGG + Intronic
1030870267 7:114747188-114747210 TTGGAGTCACAGATATTTGGAGG - Intergenic
1033008814 7:137596719-137596741 TTGGTCTCTCAGATACTGTGTGG - Intronic
1038256567 8:25956045-25956067 TTGGTACCACACATATTTGGGGG - Intronic
1041605674 8:59780021-59780043 GTGGCATCTCAGAAATTTGTGGG + Intergenic
1041706010 8:60846957-60846979 TTGGTATCTCAGAAACTTGGTGG + Intronic
1041994593 8:64038598-64038620 TTGATTTCTCACAGATTTGGAGG - Intergenic
1042481619 8:69310282-69310304 TTGATATCTCACTTATTTGAGGG + Intergenic
1044329264 8:90897226-90897248 TTGGAATCGCAGATAAGTGGTGG - Intronic
1045583643 8:103505149-103505171 TAGGTAGCTAAGAAATTTGGGGG - Intronic
1050643717 9:7695876-7695898 TTGATATTTCAGATTTTTTGAGG + Intergenic
1052241058 9:26274211-26274233 TTGCTATCCCAGATCTTTGTGGG - Intergenic
1052839069 9:33275885-33275907 TTGTAATGTCAGCTATTTGGAGG + Intronic
1056900049 9:90590317-90590339 TTTGTATCTGGGATATATGGTGG + Intergenic
1056943811 9:90977017-90977039 TTGTTATCTCAGAGATTCTGGGG - Intergenic
1057957288 9:99421052-99421074 TTGGGATCCCAAATATTTGCAGG + Intergenic
1058033381 9:100224419-100224441 TTGGTACCTCAGATATTTCAAGG - Intronic
1058232364 9:102443587-102443609 TTGGTAAATTAGATCTTTGGGGG + Intergenic
1058830638 9:108813205-108813227 TTGGTATCCCATAGATTTTGGGG + Intergenic
1058854434 9:109046708-109046730 TTGGTATCACTGATATTTGTAGG + Intronic
1059290532 9:113220320-113220342 TTGGTAGCTCACAAGTTTGGAGG + Intronic
1059627914 9:116087574-116087596 TTGGTTTCTCAGTTATCAGGAGG + Intergenic
1187741007 X:22355510-22355532 TTTGTATTTCAAATATTTGAAGG + Intergenic
1188317675 X:28694571-28694593 TTGTTATCTAAGATATATGGAGG + Intronic
1188598770 X:31934697-31934719 TTGTTGTCTCATATATTTTGGGG + Intronic
1189146919 X:38664997-38665019 ATGGTATAGCATATATTTGGTGG + Intronic
1191631774 X:63330023-63330045 TTGTTATCTTACATGTTTGGAGG - Intergenic
1193560546 X:83011947-83011969 TTGCTAGCTCAAATATTTGAGGG - Intergenic
1194150105 X:90314281-90314303 TTGGAAACTCTGTTATTTGGGGG + Intergenic
1194166513 X:90522525-90522547 TTGGTATTCCTCATATTTGGTGG + Intergenic
1194278244 X:91913672-91913694 TTGGTTTCTCAGGTGTTGGGTGG - Intronic
1198253309 X:134903152-134903174 GTGGTATCTCTGATTTGTGGAGG + Intronic
1198560085 X:137840180-137840202 TTTGAATGTCAGATATTTTGAGG - Intergenic
1200139450 X:153891763-153891785 TTGTAATCTCAGCTACTTGGGGG - Intronic
1200512782 Y:4100306-4100328 TTGGTATTCCTCATATTTGGTGG + Intergenic
1200595582 Y:5135748-5135770 TTGGTTTCTCAGGTGTTGGGTGG - Intronic
1202345318 Y:23917201-23917223 TTGGTATTTAAGTTCTTTGGAGG - Intergenic
1202525452 Y:25752888-25752910 TTGGTATTTAAGTTCTTTGGAGG + Intergenic