ID: 1080318049

View in Genome Browser
Species Human (GRCh38)
Location 11:30972367-30972389
Sequence AAGTTACCCTTCATTAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 3, 2: 28, 3: 110, 4: 533}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080318049 Original CRISPR AAGTTACCCTTCATTAATGA AGG Intronic
900012303 1:126409-126431 AACTTATCCTTCAAAAATGAAGG + Intergenic
900042363 1:482398-482420 AACTTATCCTTCAAAAATGAAGG + Intergenic
900063804 1:717388-717410 AACTTATCCTTCAAAAATGAAGG + Intergenic
904294755 1:29512416-29512438 AAAATACCCTTCATAAATGAAGG + Intergenic
904294759 1:29512423-29512445 AATTTCCCCTTCATTTATGAAGG - Intergenic
905101706 1:35529546-35529568 AAGTTATCTTTCATAAATAAAGG - Intronic
906030213 1:42713824-42713846 AAATTATCCTTCACAAATGAAGG - Intergenic
906050252 1:42865116-42865138 AAGGTATCCTTCAGAAATGAAGG + Intergenic
906573422 1:46864489-46864511 AAGTTATCCTTCATAAATGAAGG + Intergenic
906594684 1:47064444-47064466 AAACTAACCTTCATCAATGAAGG + Intergenic
906598451 1:47102560-47102582 AAGTTATCTTTCATAAATGAAGG - Intronic
907063909 1:51460381-51460403 GAGTTTCACTTCATTTATGAAGG - Intronic
908070808 1:60457451-60457473 AACTTATCATTCATAAATGAAGG + Intergenic
908538375 1:65099917-65099939 AAATTATTTTTCATTAATGAAGG - Intergenic
908545004 1:65153669-65153691 AAGTTACCCTTAATTCCTTAAGG + Intronic
908811109 1:67983062-67983084 AAATTACTCTTCCTCAATGATGG + Intergenic
908918042 1:69155869-69155891 AAATTAACCTACATAAATGAAGG - Intergenic
909463476 1:75945455-75945477 AAGTTAGCCTTCATAAATGAAGG + Intergenic
909597752 1:77425171-77425193 AAATTATCCTTCAAAAATGAAGG + Intronic
909598864 1:77440218-77440240 AAACTACCCTTCAGAAATGAGGG - Intronic
910265716 1:85334935-85334957 AAATTATCCTTCATAAATGAAGG + Intronic
910265717 1:85334942-85334964 AATTTGTCCTTCATTTATGAAGG - Intronic
910975267 1:92899874-92899896 AAGCTATCCTTCAGAAATGAGGG - Intronic
911083352 1:93955438-93955460 AAGTTACATTTCATAAATGAAGG - Intergenic
911714625 1:101116861-101116883 TAATTACTCTTCATTAATGAAGG - Intergenic
911792546 1:102036088-102036110 AAGTTATCATTCACTTATGATGG + Intergenic
913663274 1:121023552-121023574 AATTTAAGCTTCATAAATGAAGG + Intergenic
914014661 1:143806817-143806839 AATTTAAGCTTCATAAATGAAGG + Intergenic
914163159 1:145154384-145154406 AATTTAAGCTTCATAAATGAAGG - Intergenic
914653285 1:149715374-149715396 AATTTAAGCTTCATAAATGAAGG + Intergenic
915056460 1:153135683-153135705 AAGTTATCCTTTATAAATGAAGG + Intergenic
915678462 1:157554595-157554617 AAGTTAACCTAAATAAATGAGGG - Intergenic
915858828 1:159420641-159420663 AAGTTATCCTTCATATATAAAGG - Intergenic
915990157 1:160506422-160506444 AAATTATCCTTCAAAAATGAAGG + Intronic
916347424 1:163809529-163809551 AAGTCCCCCTACATAAATGAAGG - Intergenic
916386218 1:164273557-164273579 TAGTTCCCCTTGATTCATGAGGG - Intergenic
916644699 1:166771180-166771202 AGATTAACCTTCATAAATGAAGG + Intergenic
916795143 1:168160143-168160165 AAGCTATCCTTCAGAAATGAAGG - Intergenic
916943994 1:169705910-169705932 ATGTTACCCTGCATAAATGTTGG + Intronic
917607686 1:176651365-176651387 AAGCTATCCTTCATATATGAAGG - Intronic
917693803 1:177497029-177497051 AAATTACCCTTCAGTAATGAAGG + Intergenic
918493280 1:185106328-185106350 AAAGTATCCTTCAGTAATGAAGG + Intergenic
918615955 1:186543879-186543901 AAATTATCCTACATAAATGAAGG + Intergenic
918899305 1:190391836-190391858 AAGTTACCTATCTTTAATGCTGG - Intronic
919043922 1:192426807-192426829 AAGCTATCCTTCATACATGAAGG + Intergenic
919135312 1:193500490-193500512 AAGCTATCATTCATTTATGAGGG + Intergenic
919397753 1:197071485-197071507 AAGCTAGGCTTCATAAATGAAGG + Intergenic
920602596 1:207344479-207344501 AAGTTATCCTTCATAAATGAAGG - Intronic
920837096 1:209521034-209521056 AAGGTACCCTTCCTTTAGGAAGG - Intergenic
921197186 1:212769515-212769537 AAGCTATCCTTCAAAAATGAAGG + Intronic
921248128 1:213268322-213268344 AAATTATCCTTCAAAAATGAAGG + Intronic
922260734 1:223942880-223942902 AACTTATCCTTCAAAAATGAGGG + Intergenic
922736335 1:227982850-227982872 AACTTATCCTTCAAAAATGAGGG - Intergenic
923253882 1:232201801-232201823 AAATTATCCTTCAGGAATGAAGG + Intergenic
923411241 1:233711863-233711885 AAATTACCCTTGATTTGTGAAGG + Intergenic
923834653 1:237596902-237596924 AAGCTATCCTTCAGAAATGAAGG + Intronic
924068526 1:240252498-240252520 AAGTTACCCTCCATAAATGATGG - Intronic
924341909 1:243045068-243045090 AACTTATCCTTCAAAAATGAGGG + Intergenic
924372846 1:243372338-243372360 AAGTCACCCTATATTAAAGATGG + Intronic
1063186102 10:3653269-3653291 AAGTAACCCTTGAATTATGAGGG + Intergenic
1063871443 10:10421817-10421839 AAGTTACCCGGCATAAAAGAGGG - Intergenic
1064506448 10:16035549-16035571 AAGGTCCCCTTCATTGGTGAAGG - Intergenic
1064572751 10:16712936-16712958 AAGTTATCCTTCAGAAATGAAGG - Intronic
1065041583 10:21703237-21703259 AAATTATCCTTCATAAATGAAGG - Intronic
1065662964 10:28025338-28025360 AAGTTACCATACATTGCTGATGG - Intergenic
1065708047 10:28489284-28489306 AGGTTCCCCTTCAGGAATGAAGG + Intergenic
1066487436 10:35860425-35860447 AAATTAAGCTTCATAAATGAAGG + Intergenic
1067581023 10:47445968-47445990 AAGTTACTCTTTAGGAATGAAGG + Intergenic
1067906633 10:50297859-50297881 CAGCTATCCTTCATAAATGAAGG + Intergenic
1068069514 10:52179326-52179348 AAACTATCCTTCAGTAATGAAGG - Intronic
1068172949 10:53420216-53420238 AAACTACGCTTCATAAATGAAGG - Intergenic
1068365550 10:56044873-56044895 TAGCTTCCCTTCATTAAGGAGGG - Intergenic
1068888423 10:62122939-62122961 AAGTTAGCCTTCAGAAATGAAGG - Intergenic
1069012391 10:63388383-63388405 ATGTTATCCTTCATAAATGATGG + Intronic
1069262599 10:66416708-66416730 AAATTATCCTTCATAAATGAAGG + Intronic
1070060567 10:72979393-72979415 AAGCTATCCTTCAAAAATGAAGG - Intergenic
1071004753 10:80869992-80870014 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1071617051 10:87084881-87084903 AAGTTACGCTACATTATTGTGGG - Intronic
1072341949 10:94460354-94460376 AAGTTATCCTTCAAAAGTGAAGG - Intronic
1072867243 10:99076948-99076970 AAATTGTCCTTCAATAATGATGG - Intronic
1074647379 10:115474197-115474219 ATGTTGCCCTTCAGAAATGAAGG - Intronic
1076271303 10:129154606-129154628 AAGTTATTCTTCATTTATCAAGG - Intergenic
1076968635 11:118613-118635 AACTTATCCTTCAAAAATGAAGG + Intergenic
1078746642 11:14121840-14121862 AAGATATCCTTCAAAAATGAGGG - Intronic
1079533897 11:21487355-21487377 AAATTACCCTTCATAAGTGAGGG + Intronic
1079935617 11:26612736-26612758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1080221600 11:29911924-29911946 AGGTTATTCTTCTTTAATGAAGG + Intergenic
1080318049 11:30972367-30972389 AAGTTACCCTTCATTAATGAAGG + Intronic
1080318051 11:30972374-30972396 TATTTCTCCTTCATTAATGAAGG - Intronic
1080637814 11:34139115-34139137 TGTTTACCCTTCATCAATGATGG + Intronic
1082911257 11:58377204-58377226 AAGTTATCCTTCAGAAATGAAGG + Intergenic
1083730606 11:64650582-64650604 GAGTTCCCCTTCATCAAGGACGG + Exonic
1084358607 11:68655259-68655281 AATTTACTTTTCATTATTGATGG + Intergenic
1084998723 11:73009636-73009658 AAATTATCCTTCATAAATGAAGG - Intronic
1085978830 11:81695914-81695936 AGATTATCCTTCATAAATGAGGG + Intergenic
1086996393 11:93361186-93361208 AATTTCCCCTTCATTCCTGAGGG - Intronic
1087227609 11:95619668-95619690 AAATTATCCTTCATAAATAACGG + Intergenic
1087353450 11:97062411-97062433 AAATTATCCTTCATAAATGAAGG + Intergenic
1087488722 11:98793636-98793658 AAGCTATCTTTCATAAATGAAGG + Intergenic
1087700150 11:101428093-101428115 AAATTATCCTTCAGAAATGAAGG - Intergenic
1087937470 11:104051420-104051442 ATCTTACACATCATTAATGAAGG - Intronic
1088719327 11:112578009-112578031 AAATTAACCTTCATTATTTAAGG - Intergenic
1089569863 11:119398461-119398483 AAGCTACTCTTCAGAAATGAAGG + Intergenic
1089841381 11:121421145-121421167 AAGTTACCAGTCACTAAAGAGGG + Intergenic
1090157054 11:124449787-124449809 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1090549164 11:127800233-127800255 AAGAAACTCTTCATGAATGAAGG - Intergenic
1090911785 11:131127502-131127524 AAGTTGCTCTTCATAAATGAAGG - Intergenic
1091508438 12:1097295-1097317 AAACAACCCTTCATTAAGGAAGG - Intronic
1091613423 12:2031035-2031057 AACTTACCCATAATTAAGGATGG + Intronic
1091839517 12:3610104-3610126 AATTTATCCTTCATTTTTGAAGG - Intronic
1092313550 12:7384694-7384716 AAGTTACCCTTCAAAAATGAAGG + Intronic
1092568113 12:9690263-9690285 AAGTTGTCCTTCAAGAATGAAGG + Intronic
1092700145 12:11219336-11219358 AAACTAACCTTCATAAATGAAGG + Intergenic
1092700161 12:11219492-11219514 AAACTAACCTTCATAAATGAAGG + Intergenic
1092735045 12:11573935-11573957 AAATTATCCTTCAAAAATGAGGG - Intergenic
1093361452 12:18234342-18234364 AAATTATCCTTCATAAATGAGGG - Intronic
1093383496 12:18522471-18522493 AAGTTGTCCTTCAGAAATGAGGG - Intronic
1093571916 12:20676313-20676335 AAGTTGTCCTTTATAAATGAAGG - Intronic
1094258780 12:28466616-28466638 AAATTATCCTTCAGTCATGAAGG + Intronic
1094296029 12:28906229-28906251 AAATTATCCTTCAAAAATGATGG + Intergenic
1094364684 12:29667805-29667827 AAGTTTCAATTCATTAGTGATGG + Intronic
1095911022 12:47426484-47426506 AAGTTATTCTTCATGAATGAAGG + Intergenic
1097329129 12:58314149-58314171 AAATTTCCATTCATTCATGAGGG - Intergenic
1097362946 12:58678418-58678440 AAATTATCCTTCATAAATTAAGG - Intronic
1097425852 12:59444080-59444102 AAAATACCCTTCAAAAATGAAGG - Intergenic
1097486886 12:60213986-60214008 AAGTTACCCTTCAAGTATGAGGG - Intergenic
1099075881 12:78107647-78107669 AAATTATCCTTCATAAATGAAGG + Intronic
1099192288 12:79572964-79572986 AAATTATCCTTCACAAATGAAGG + Intergenic
1099587829 12:84544291-84544313 AAGTTATCCTTCATTAATGAAGG - Intergenic
1100900974 12:99239812-99239834 AAATTATGCTTCATAAATGAAGG + Intronic
1101270204 12:103135034-103135056 AAATTATCCTTCATTAATTAAGG + Intergenic
1101568134 12:105928858-105928880 AAGTTACCATTTATTACTCAGGG + Intergenic
1102443711 12:112984893-112984915 AAGCTATCCTTCAAAAATGAAGG - Intronic
1104678910 12:130735423-130735445 AAATTATCCTTCAAAAATGAAGG - Intergenic
1105478780 13:20754212-20754234 AAATTATTCTTCATAAATGAAGG - Intronic
1105877954 13:24576125-24576147 AAGTTATCTTTCATAAATGAAGG - Intergenic
1106723290 13:32457629-32457651 AAGTTATCCTTCAAAAATTAAGG + Intronic
1107981882 13:45741840-45741862 ATGTTTCTCTTCAATAATGAAGG - Intergenic
1108369019 13:49748900-49748922 AAATAACACTTCATTAATGTTGG - Intronic
1109071698 13:57777687-57777709 AACTTATCCTTCATAAATAAAGG - Intergenic
1109362184 13:61308088-61308110 ATGTTACATTTTATTAATGAGGG - Intergenic
1109550788 13:63896338-63896360 AAGTTAGCCTTCCTTATTAAGGG - Intergenic
1109681731 13:65759962-65759984 CAGTTATCCTTCATAAATGAAGG + Intergenic
1109807971 13:67469290-67469312 AAGTTATCCTTCATAAATGAAGG - Intergenic
1109928221 13:69176067-69176089 AAATTACGCTTCAAAAATGAAGG + Intergenic
1109942348 13:69386516-69386538 AAGTCATCCTTCAGAAATGAGGG + Intergenic
1111049658 13:82864241-82864263 AAGGTAGACTTCATTATTGATGG - Intergenic
1111722035 13:91957691-91957713 AAGTTATCCTTTATAAATAAAGG + Intronic
1112060433 13:95734263-95734285 AAGTTATCCTTCATAAATGAAGG - Intronic
1112080214 13:95960934-95960956 AAGTTATCCTTCATAAATGAAGG + Intronic
1112228594 13:97565652-97565674 AAGTCACCTTTCTTTAATGATGG - Intergenic
1112546725 13:100378167-100378189 TATTTCTCCTTCATTAATGAAGG + Intronic
1112546726 13:100378174-100378196 ATAATATCCTTCATTAATGAAGG - Intronic
1112749065 13:102562944-102562966 AAGCTATCCTTCAAAAATGAGGG - Intergenic
1112844956 13:103630722-103630744 AAAATACCCTTCAAGAATGACGG - Intergenic
1113754138 13:112797675-112797697 AAATTATCCTTCATTCGTGAAGG + Intronic
1115082409 14:29472356-29472378 AATTTTCCCTTCATTTTTGAAGG + Intergenic
1115082412 14:29472363-29472385 AAGCTACCCTTCAAAAATGAAGG - Intergenic
1115695691 14:35896590-35896612 AAATTATTCTTCATAAATGAAGG - Intronic
1116685933 14:48038643-48038665 AAGTTATCCTTCACAAATGAAGG - Intergenic
1117344503 14:54819008-54819030 AAGCTTCCCTTAATCAATGATGG - Intergenic
1117733481 14:58746865-58746887 AAATTCCCCTTCTATAATGAGGG - Intergenic
1117759531 14:59012726-59012748 ATATTACCCTTCATAAATGAAGG - Intergenic
1117940400 14:60958263-60958285 AAGCTATCCTTCACCAATGAGGG - Intronic
1118499010 14:66339106-66339128 AAGTTATCATTCAAAAATGAAGG + Intergenic
1118546534 14:66895664-66895686 AAGTTACCATTCAAGAATGGGGG + Intronic
1118569501 14:67178966-67178988 AAGCTATCCTTCAGGAATGAGGG + Intronic
1118933198 14:70262202-70262224 ACGTTACCCTTCAGTATTTATGG + Intergenic
1119072776 14:71604619-71604641 CAGTTATCCTTCATAAATGAAGG - Intronic
1120777149 14:88450542-88450564 AAATTAAGCTTCATAAATGAAGG - Intronic
1121399907 14:93665778-93665800 AAGCTATCCTTCAAGAATGAAGG + Intronic
1121784572 14:96647487-96647509 AAGTTGTCATTCATAAATGAAGG - Intergenic
1124171673 15:27379655-27379677 AAACTACCCTTCAAAAATGAAGG - Intronic
1124443351 15:29706328-29706350 AGGTTGCAATTCATTAATGAAGG - Intronic
1124823589 15:33071387-33071409 AAGTCATGCTTCATAAATGAAGG - Intronic
1124942919 15:34235058-34235080 AAGTCTCCCTTCCTTAAAGAGGG + Intronic
1125246997 15:37651952-37651974 AAGGTACTCTTCATAAATGATGG + Intergenic
1125365452 15:38910321-38910343 AAGTTATCCTTCAAGTATGAAGG - Intergenic
1125846953 15:42864647-42864669 AAATTATCCTTCAGAAATGAAGG + Intronic
1126252586 15:46586555-46586577 AACTTATCCTTCATAAATGAGGG - Intergenic
1126480411 15:49112408-49112430 AAGTTATCCTTCATAAATGAAGG + Intronic
1126490149 15:49227954-49227976 CAGTTCTCCTTCATTTATGAAGG + Intronic
1126490150 15:49227961-49227983 AAATCATCCTTCATAAATGAAGG - Intronic
1126963575 15:54026282-54026304 TAGTTACCGGTCATTAATGTAGG + Intronic
1126996543 15:54450974-54450996 AAGTTATCCTTCATAAATAAAGG - Intronic
1127014674 15:54670227-54670249 AAACTAACCTTCATAAATGAAGG + Intergenic
1127339269 15:58023703-58023725 AAATTATCCTTCACAAATGAGGG + Intronic
1127694496 15:61432013-61432035 AAACTAACCTTCATAAATGAAGG - Intergenic
1127824174 15:62689612-62689634 TATTTCCCCTTCATTCATGAAGG + Intronic
1127824177 15:62689619-62689641 AAATTATCCTTCATGAATGAAGG - Intronic
1128393957 15:67204312-67204334 TAGTTACTCTTCATTTGTGAGGG - Intronic
1129070780 15:72948729-72948751 CAGTTATCCTTCATAAATAAAGG + Intergenic
1130142377 15:81238864-81238886 AAACTACCCTTCAGGAATGATGG - Intronic
1130166423 15:81464906-81464928 AAGTTATCTGTCATAAATGAAGG - Intergenic
1130218223 15:81993210-81993232 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1130249641 15:82290359-82290381 AAATTACTCTTCATAAGTGAAGG + Intergenic
1130398564 15:83528034-83528056 AAGTTATCCTTCATAAAATAAGG - Intronic
1130450467 15:84046138-84046160 AAATTACTCTTCATAAGTGAAGG - Intergenic
1130692998 15:86102526-86102548 AAGTTATCCTTCATAAATGAAGG - Intergenic
1130768744 15:86902637-86902659 AAGTTTCCCTTCATTCTGGAAGG + Intronic
1130786777 15:87106114-87106136 AGGTTAACCTTTATAAATGAAGG + Intergenic
1131987347 15:98057164-98057186 AAGTTATCCTTCATCAATGAAGG - Intergenic
1132319003 15:100911207-100911229 AAGTTCCCCTTTTTTAATGCTGG + Intronic
1133881962 16:9790737-9790759 AAGGTCCCTTTCATTAAAGAAGG + Intronic
1134255320 16:12605624-12605646 AAACTAAGCTTCATTAATGAAGG + Intergenic
1134326599 16:13213344-13213366 AAGTTAGCATTAAATAATGAAGG + Intronic
1135280001 16:21146107-21146129 AAGTCACCCTTCAAAAATTAGGG + Intronic
1137341819 16:47614967-47614989 TAACTACCCTTCAGTAATGAAGG - Intronic
1137957841 16:52851043-52851065 AAGTTATTCTTCATAAATGTAGG - Intergenic
1138020700 16:53478028-53478050 AAGTTATCTTTCAGAAATGAAGG - Intronic
1140156121 16:72428534-72428556 AGGTGACTGTTCATTAATGAAGG - Intergenic
1140325953 16:74003720-74003742 AAGCTATCCTTCAAAAATGATGG - Intergenic
1141024652 16:80534196-80534218 AAAATACCCTTCAGTAATAAAGG - Intergenic
1142452042 16:90180512-90180534 AACTTATCCTTCAAAAATGAAGG - Intergenic
1143227620 17:5320283-5320305 AAGTTATCCTTCAAATATGAAGG + Intronic
1144644101 17:16957754-16957776 AAATCACCTTTCAATAATGAAGG + Intronic
1145181950 17:20761039-20761061 AGTTTTCCCTTCATTAATGAAGG + Intergenic
1145181952 17:20761046-20761068 AAAATATCCTTCATTAATGAAGG - Intergenic
1146298350 17:31669167-31669189 AAACTACGCTTCATAAATGAAGG - Intergenic
1149168510 17:53781885-53781907 AAATTAAGCTTCATAAATGAAGG + Intergenic
1149841846 17:59972202-59972224 AGTTTTCCCTTCATTAATGAAGG + Intronic
1149841848 17:59972209-59972231 AAAATATCCTTCATTAATGAAGG - Intronic
1149931457 17:60760438-60760460 AAATTATCCTTCATGAATGAAGG - Intronic
1149943525 17:60897150-60897172 AAATTACCCTTCATAAATGAAGG - Intronic
1150916295 17:69440680-69440702 AAAATACCCTTCAGAAATGAAGG - Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154075229 18:11194074-11194096 TTGTTTCCCTTCATTCATGAAGG + Intergenic
1155088208 18:22477988-22478010 AAGTTATACTTCATAAGTGAAGG + Intergenic
1155807500 18:30190815-30190837 AAATGATCCTTCATAAATGAAGG - Intergenic
1156135649 18:34033942-34033964 AAATTAACCCTCATAAATGAAGG + Intronic
1156432888 18:37094400-37094422 AAGTTATCCTTCAAAAATGAAGG + Intronic
1156653368 18:39253748-39253770 AACTTACACTTGATAAATGAAGG + Intergenic
1156893196 18:42214010-42214032 AAACTACACTTCATAAATGAAGG - Intergenic
1157708341 18:49828299-49828321 AAACTACCCTTCAAGAATGAAGG + Intronic
1158097811 18:53794238-53794260 AAGCTACGCTTTATAAATGAAGG + Intergenic
1158735798 18:60077211-60077233 AAGTTATCTTTCATTAATGAAGG + Intergenic
1159821358 18:73149167-73149189 AAGTTATCCTTTAGAAATGAAGG - Intergenic
1159896947 18:74006304-74006326 AATTTTCCTTTCACTAATGAGGG + Intergenic
1160252743 18:77217928-77217950 AAGACAGCCTTCATTAAGGAGGG + Intergenic
1160465942 18:79076392-79076414 AAATTATCCTTCAGGAATGAAGG - Intronic
1160645444 19:188539-188561 AACTTATCCTTCAAAAATGAAGG + Intergenic
1161741813 19:6025676-6025698 AAAATACCCTTCAGCAATGAAGG - Intronic
1162002579 19:7756495-7756517 AAGTTATTCTTCAAAAATGAAGG - Intergenic
1163975061 19:20842885-20842907 AAATTAACCTTCATAAGTGAAGG + Intronic
1164424501 19:28128903-28128925 AATTTAAGCTTCATGAATGAGGG + Intergenic
1164497580 19:28782034-28782056 AAATTAAGCTTCATAAATGAAGG - Intergenic
1164742880 19:30589764-30589786 AAGCAACCCTCCATCAATGATGG - Intronic
1164946878 19:32302842-32302864 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1165017586 19:32892728-32892750 AAGTTATCCTTCATAAATGAAGG + Intronic
1165189034 19:34046997-34047019 AAAATGCCCTTCACTAATGAAGG + Intergenic
1165537406 19:36460958-36460980 AAAATATCCTTCAGTAATGAAGG + Intronic
1166623036 19:44321728-44321750 AAGTTATCCTTCAAATATGAAGG - Intergenic
1167814416 19:51867453-51867475 AAGTTGTCCTTCATTAAGGGAGG - Intronic
1168634603 19:57986109-57986131 AAATTATCCTTCAAAAATGAAGG + Intronic
924968996 2:106923-106945 AAATTATCCTTTATAAATGAAGG - Intergenic
925127297 2:1468452-1468474 AAGCTAAGCTTCATAAATGAAGG - Intronic
925478137 2:4242060-4242082 ATGGTACCCCTCATTAATGATGG - Intergenic
925570569 2:5307775-5307797 AAAATAACCTTCATCAATGAAGG - Intergenic
925951832 2:8921638-8921660 AAATTATCCTTCAAGAATGAAGG - Intronic
926575598 2:14576779-14576801 AAAATACCCTTCAGGAATGAAGG - Intergenic
926617582 2:15012801-15012823 AAACTACCCTTCAGAAATGAAGG + Intergenic
926967641 2:18432755-18432777 AAGTTGACCCTCATTAATCATGG + Intergenic
927052378 2:19343046-19343068 AAATTAACCTTCAAGAATGAAGG + Intergenic
927161753 2:20269881-20269903 AAATTCCCCTTGATGAATGAGGG - Intronic
927233040 2:20843990-20844012 AAGTCAGCATTCATTAATGGAGG - Intergenic
927352090 2:22127568-22127590 AAGCTGCCCTTCAGAAATGAAGG + Intergenic
928067262 2:28177305-28177327 AAGTTATCTTTCACAAATGAAGG + Intronic
928757109 2:34540397-34540419 AAATTATCCTTCATAAATGAAGG - Intergenic
928849218 2:35722196-35722218 AAGCTATCCTTCAGAAATGAAGG + Intergenic
929734596 2:44533558-44533580 AAATTATTCTTCATAAATGAAGG + Intronic
929812511 2:45202589-45202611 AAGTTTCCCTTCAAAAATAAAGG + Intergenic
931134327 2:59378889-59378911 AAGTTACTATTCAAAAATGAAGG + Intergenic
932526355 2:72473998-72474020 AAATTATTCTTCATAAATGAAGG - Intronic
933398083 2:81756701-81756723 AAACTAACCTTCATAAATGAAGG + Intergenic
933863728 2:86497169-86497191 AAATTATCCTTCAAGAATGAAGG - Intergenic
934722244 2:96588389-96588411 ATTTTACCTTTCATTAATGAAGG - Intergenic
934982344 2:98853384-98853406 AAATTATCCTTCAATAATGAAGG + Intronic
935491417 2:103724928-103724950 AAGTTGTCCTTCACAAATGAAGG - Intergenic
935964512 2:108460674-108460696 AAATTATCCTTCATAAATGAAGG - Intronic
936245328 2:110821308-110821330 TAGTTTCTATTCATTAATGAAGG + Intronic
936292972 2:111241301-111241323 AAATTATCCTTCAAGAATGAAGG + Intergenic
936574720 2:113643469-113643491 CAGCTACCCTTCATTGATAAGGG - Intergenic
936595460 2:113843044-113843066 AAGTTATCTTTCAGTAAAGAGGG + Intergenic
937194211 2:120135749-120135771 AAGATACCCTTCAAACATGAAGG + Intronic
937444162 2:121942588-121942610 AAGCTAACATTCACTAATGAAGG - Intergenic
937614215 2:123901408-123901430 AAGTTATCATTCAAAAATGAGGG - Intergenic
939065377 2:137477823-137477845 AAGTTACCCTTCATAAATGAAGG - Intronic
939449381 2:142353246-142353268 AAATTAAGCTTCATAAATGAAGG + Intergenic
939847502 2:147266446-147266468 AAATTATCCTTCAAAAATGAAGG - Intergenic
940528862 2:154853520-154853542 AAATTACACTTAATTATTGAGGG + Intronic
940557839 2:155254886-155254908 AAATTATCCTTCATAAGTGAAGG - Intergenic
941674679 2:168330806-168330828 AATTTATCTTTCATAAATGAAGG + Intergenic
942056347 2:172187181-172187203 AAATTATCCTTCAAAAATGAAGG - Intergenic
942939560 2:181600100-181600122 AAATTAAGCTTCATAAATGAAGG + Intronic
943276860 2:185878211-185878233 AAATTAAGCTTCATCAATGAAGG + Intergenic
943608161 2:190000612-190000634 AGGTTTACCTTCATTAATGAAGG + Intronic
943608162 2:190000619-190000641 GAACTAACCTTCATTAATGAAGG - Intronic
944269117 2:197760996-197761018 AAGCTATCCTTCAGAAATGAAGG + Intronic
945354659 2:208825518-208825540 AAGTTACCCTTCAGAAATGACGG + Intronic
945377209 2:209093159-209093181 AAATTAAGCTTCATAAATGAAGG - Intergenic
946694154 2:222335204-222335226 AAGTTATCCTTCATAAATGAAGG + Intergenic
947043573 2:225951396-225951418 AAGTTACCCTTCATAAATAAAGG + Intergenic
947678110 2:232003681-232003703 AAAATATCCTTCAGTAATGAAGG - Intronic
948511480 2:238468380-238468402 AAGATATCCTTCAGAAATGAAGG - Intergenic
948812628 2:240491652-240491674 AAATTATCTTTCATAAATGAAGG - Intronic
949083468 2:242125062-242125084 AACTTATCCTTCAAAAATGAGGG - Intergenic
1169007354 20:2219549-2219571 AAATTATCCTTCATGAATAAAGG - Intergenic
1169412601 20:5384594-5384616 AAGTTATCCTTCATAAATGAAGG + Intergenic
1170093513 20:12618914-12618936 AAGTTATTCTTCATAAATGAAGG + Intergenic
1170330668 20:15207302-15207324 AACTTATCCTTCAGGAATGAAGG - Intronic
1170392310 20:15889004-15889026 AAGTAGCCCTTCATTAGTGTCGG - Intronic
1170657948 20:18307360-18307382 AAGATACACTTCAAGAATGAAGG - Intronic
1170769988 20:19324260-19324282 AATTTTCCCTTCTCTAATGAGGG - Intronic
1170964338 20:21052786-21052808 GAGTGACCCTCCATCAATGAAGG - Intergenic
1171001507 20:21420829-21420851 AAGATATCCTTCATAAATGAAGG - Intergenic
1172050184 20:32111102-32111124 AACTTACCTTTGTTTAATGAGGG + Intronic
1173230324 20:41190780-41190802 AAATTATCCTTCATAAATGAAGG - Intronic
1173483281 20:43420390-43420412 AAGCTATCCTTCAAAAATGAAGG + Intergenic
1173717060 20:45217646-45217668 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1173769226 20:45643864-45643886 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1176055764 20:63147585-63147607 AAGCTATCCTTCATAAATGAGGG - Intergenic
1176280062 20:64297687-64297709 AACTTATCCTTCAAAAATGAGGG - Intergenic
1176360584 21:5993633-5993655 AAGTTATCCTTCAGAAATGAGGG - Intergenic
1177554801 21:22675394-22675416 GAGTGACCCTACATTAATGAGGG + Intergenic
1177998083 21:28128284-28128306 AAGGTTCCCTTCATTAGGGAAGG - Intergenic
1178679590 21:34661684-34661706 AAGTTATCCTTCTTAAATGAAGG + Intergenic
1179019822 21:37628940-37628962 AAATTATCCTTCACAAATGAAGG + Intronic
1179585044 21:42369471-42369493 AGGTTAGCATCCATTAATGAGGG + Intergenic
1179762934 21:43544917-43544939 AAGTTATCCTTCAGAAATGAGGG + Intronic
1181448358 22:22997840-22997862 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1182971092 22:34577721-34577743 AAATTACCCTTCAAAAGTGAAGG - Intergenic
1184480973 22:44746934-44746956 AAATTGCCCTTCTTTCATGAGGG + Intronic
1185090579 22:48768262-48768284 AAAATATCCTTCAGTAATGAAGG - Intronic
949427964 3:3940117-3940139 AAATTAAGCTTCATAAATGAAGG - Intronic
949754135 3:7390100-7390122 AAATTAAGCTTCATAAATGAAGG - Intronic
949793917 3:7824864-7824886 AAGTTATCCTTCAGAAATGAAGG + Intergenic
950701244 3:14750220-14750242 AAGCTATCCTTCAAAAATGAAGG - Intronic
951134070 3:19083153-19083175 AAATTATCCTTCAAAAATGAAGG + Intergenic
951257432 3:20466736-20466758 AAATTACCCTTCAATAGAGAAGG - Intergenic
952016938 3:28969058-28969080 AAATTACCCTTCTTAAATGAAGG - Intergenic
952243526 3:31560497-31560519 AAATTATCCTTCATAAATGAAGG - Intronic
952594613 3:35000959-35000981 AATTTCCCCTTCATTTCTGAAGG - Intergenic
952699836 3:36315488-36315510 AAGTTATCTTTCATAAATGAAGG - Intergenic
952939871 3:38434470-38434492 AAGTTACCCTTCATAAATGAAGG + Intergenic
953220546 3:40967619-40967641 AACTTATTCTTCATAAATGAGGG - Intergenic
953720308 3:45349360-45349382 AAGCTTCCCTTCATTTCTGAAGG - Intergenic
955450585 3:59063086-59063108 AAACTACGCTTCATAAATGAAGG - Intergenic
956164820 3:66388758-66388780 AATTTCCCCTTCATTTTTGAAGG - Intronic
956706366 3:72002532-72002554 AAGTTGCCCTTCCTTTGTGAAGG + Intergenic
957066407 3:75526497-75526519 AAGCTATCCTTCACAAATGAAGG + Intergenic
957289877 3:78266415-78266437 AAATTATTCTTCATAAATGAAGG - Intergenic
957570633 3:81943728-81943750 AAGTTGCCCTTCAGAAATCAAGG - Intergenic
957814683 3:85280276-85280298 AAACTACCCTTCAACAATGAAGG - Intronic
958545644 3:95546135-95546157 AAGTTACCTTTCAAATATGAAGG + Intergenic
958678406 3:97294840-97294862 AAGTTATCCTTCATAAATGAAGG - Intronic
958695335 3:97520452-97520474 AAGTTATCCTTCATAAATGAAGG - Intronic
958789642 3:98636372-98636394 AAGGTATTCTTCATAAATGAAGG + Intergenic
959217543 3:103471529-103471551 AAATTGCCCTTTTTTAATGAGGG + Intergenic
959218364 3:103482420-103482442 AAATTAACCTTCATAAGTGAAGG - Intergenic
960761857 3:121080567-121080589 AAATTAAGCTTCATGAATGAAGG - Intronic
960769725 3:121180333-121180355 AAACTAAGCTTCATTAATGAAGG + Intronic
961286738 3:125811562-125811584 AAGATATCCTTCACAAATGAAGG - Intergenic
962650057 3:137479450-137479472 AAGTTGCCCTTAATTTATTATGG - Intergenic
962823354 3:139074659-139074681 AAGTTATTATTCATAAATGAAGG + Intronic
963387761 3:144618865-144618887 AAACTAGCCTTCATAAATGAAGG - Intergenic
963829898 3:149995129-149995151 AAGTTATCCTTCATAAGTGAAGG + Intronic
964075831 3:152690176-152690198 AAACTAACCTTCATAAATGATGG + Intergenic
964173554 3:153798680-153798702 AAACTAAGCTTCATTAATGAAGG + Intergenic
964393532 3:156221811-156221833 AAACTACGCTTCATAAATGAAGG + Intronic
964704081 3:159599954-159599976 AAATTATCCTTCATAAATGAAGG - Intronic
964901837 3:161669465-161669487 AAATTACCCTTCATAAAGGAAGG - Intergenic
964921576 3:161902955-161902977 AATTGTTCCTTCATTAATGAAGG + Intergenic
965291170 3:166882952-166882974 AAATTAACTTTCATAAATGAAGG + Intergenic
965717456 3:171621490-171621512 AAGTTTCCATTTATTACTGATGG + Intronic
966284701 3:178280216-178280238 AAGTTATTCTTCAGAAATGAAGG + Intergenic
966346041 3:178981419-178981441 AAGTTATCCTTCATAAATGAAGG - Intergenic
966905723 3:184524644-184524666 AACTTACCCATCAATAATCATGG - Intronic
967944819 3:194795737-194795759 AAGTTATCCTTCATAAATGAAGG - Intergenic
968253137 3:197241304-197241326 AAATTACCCTTCACATATGAAGG + Intronic
968372239 3:198230987-198231009 AACTTATCCTTCAAAAATGAAGG - Intergenic
968390185 4:186229-186251 AAGTTAAGCTTCATAAGTGAAGG - Intergenic
968709607 4:2103868-2103890 AATATAACCTTCATAAATGAAGG + Intronic
969011011 4:4062554-4062576 AAGCTATCCTTCACAAATGAAGG + Intergenic
969275411 4:6131855-6131877 AAATTATCCTTCAAAAATGAAGG + Intronic
969743055 4:9047342-9047364 AAGCTATCCTTCACAAATGAAGG - Intergenic
969802437 4:9579422-9579444 AAGCTATCCTTCACAAATGAAGG - Intergenic
970283125 4:14480021-14480043 AAGCTAAGCTTCATAAATGAAGG + Intergenic
970783247 4:19765690-19765712 AAGCTATCCTTCATTACTGAAGG - Intergenic
971023954 4:22569645-22569667 AAGTTATCATTTATGAATGAAGG - Intergenic
971703546 4:30011263-30011285 AAGTTATCCTTCATAAATGAAGG - Intergenic
972122031 4:35715016-35715038 AAATTATCCTTCATAAATGAAGG + Intergenic
973799464 4:54461978-54462000 AAATTAACCTTCATAAGTGAAGG + Intergenic
974127298 4:57711640-57711662 AAATTAAGCTTCATAAATGAAGG + Intergenic
974196595 4:58583857-58583879 AAACTAACCTTCATAAATGAAGG - Intergenic
974371803 4:61026526-61026548 AAATTACCTTTCAAAAATGAAGG - Intergenic
974589811 4:63930883-63930905 AATTTACCCTTCATTCACGAAGG + Intergenic
974589813 4:63930890-63930912 AAGTTATCCTTCGTGAATGAAGG - Intergenic
975203438 4:71617698-71617720 AAGTTAAGCTTCATAAGTGAAGG + Intergenic
975261371 4:72303445-72303467 AAGATATCCTTCAAAAATGAGGG + Intronic
976040835 4:80882818-80882840 AAGCTATCCTTCAGAAATGAAGG + Intronic
976073390 4:81269128-81269150 AAGCTATCCTTCACAAATGAGGG - Intergenic
977010833 4:91630490-91630512 AAGTTATACTTAAGTAATGAAGG + Intergenic
977219861 4:94325927-94325949 AAGCTATCCTTCAAAAATGAAGG - Intronic
977398048 4:96496085-96496107 AAACTACCCTTCAGAAATGAAGG + Intergenic
977418148 4:96762274-96762296 AACTTATCCTTCAAAAATGAAGG - Intergenic
977830184 4:101581443-101581465 AAGTTATCCTTCAGAAATAAAGG - Intronic
977926641 4:102707332-102707354 AATTTATCCTTCATAAATAAAGG + Intronic
978201813 4:106031386-106031408 AAACTACACTTCATAAATGAAGG - Intergenic
978762002 4:112362981-112363003 AAATTAAGCTTCATAAATGAAGG + Intronic
978824105 4:113000310-113000332 AAATTTCCCTTCGTGAATGAAGG - Intronic
978916291 4:114129250-114129272 AAATTAGGCTTCATAAATGAAGG + Intergenic
978930811 4:114309466-114309488 AAACTATCCTTCATAAATGAAGG + Intergenic
979215597 4:118160310-118160332 AAATTGTCCTTCAATAATGAAGG + Intronic
979500858 4:121438300-121438322 AATTTATCCTTCATAAATGATGG - Intergenic
980144623 4:128966745-128966767 AAGTTATACTTCAAAAATGAAGG - Intronic
980533878 4:134089906-134089928 AACATACCCTTCATAAATAAGGG + Intergenic
981169650 4:141606159-141606181 AAGTTACCCTTCATGCTTGATGG - Intergenic
981178148 4:141706659-141706681 AAGCTATCCTTCAAAAATGAAGG - Intronic
982405878 4:155020021-155020043 AAATTAAGCTTCATAAATGAAGG - Intergenic
982493438 4:156059077-156059099 TAGTTTACCTTCATTATTGAAGG + Intergenic
983277616 4:165637141-165637163 AAACTAACCTTCATAAATGAAGG + Intergenic
983488797 4:168363207-168363229 AAGCTATCCTTCAGAAATGAAGG + Intronic
983593888 4:169443949-169443971 AAGCTATCCTTCAAAAATGAAGG + Intronic
983666177 4:170187131-170187153 AAGTTGCCCTTCAGAATTGAAGG - Intergenic
983894689 4:173069495-173069517 AAGTTATCCCTCAGAAATGAAGG - Intergenic
984209412 4:176827100-176827122 AAATTACCCTTCAAAAATAAAGG + Intergenic
985989923 5:3547917-3547939 AAATTATTCTTTATTAATGAAGG + Intergenic
986277341 5:6288436-6288458 AAATTATCCTTCAAAAATGAAGG + Intergenic
986552378 5:8972846-8972868 AAGTTATCCTTCAAAAATGAAGG - Intergenic
986873944 5:12082966-12082988 AAGTTACATTTCTTAAATGAAGG + Intergenic
987717294 5:21588606-21588628 AAGTAGCTCTTCATTATTGAAGG + Intergenic
988237371 5:28562516-28562538 AAGTTATCATTCATAGATGAAGG + Intergenic
989081634 5:37629012-37629034 AAGCTATCCTTCAGAAATGAAGG - Intronic
989828244 5:45885478-45885500 AAATTAAGCTTCATAAATGAAGG - Intergenic
990112480 5:52344943-52344965 AAGTTATTCTTAATTAAAGAGGG - Intergenic
990396291 5:55383410-55383432 AAGTTACCTTTCAAAAATGAAGG - Intronic
991161097 5:63504158-63504180 AAGTTAAGCTGCATAAATGAAGG - Intergenic
991726570 5:69541509-69541531 GAATTACCCTTCATAAATCAAGG + Intronic
991868387 5:71086365-71086387 GAATTACCCTTCATAAATCAAGG - Intergenic
992170432 5:74096333-74096355 AAGATACACTTCATAAGTGAAGG + Intergenic
993022454 5:82607453-82607475 AAGTTATCCTTCATAAACTAAGG + Intergenic
993080278 5:83288525-83288547 AAATTATCCTTCAATAGTGAAGG - Intronic
993562932 5:89433994-89434016 AAGTTATTCTTCCTTTATGAAGG - Intergenic
993623528 5:90194920-90194942 AAGATACCCTTCAAACATGAAGG + Intergenic
993846571 5:92951902-92951924 AAGTTGCCATTCATAAATGAGGG - Intergenic
993933252 5:93968948-93968970 AAGTTATCCTTCAAAAGTGAGGG + Intronic
994034518 5:95183733-95183755 ATGTCCACCTTCATTAATGAAGG + Intronic
994062010 5:95488581-95488603 AAGTTATTCTTCATAAATGAAGG + Intronic
994208056 5:97058158-97058180 AAACTAGGCTTCATTAATGAAGG - Intergenic
994792851 5:104253396-104253418 AAGTTATCCTTCAAATATGAAGG - Intergenic
995071274 5:107924455-107924477 AAATTAATCATCATTAATGAAGG + Intronic
995278878 5:110309957-110309979 AAGTTATCCTTCAAATATGAAGG + Intronic
995315410 5:110765798-110765820 AAACTACCCTTCAAGAATGAAGG + Intergenic
995990549 5:118233630-118233652 ATGTTATCCTTTATGAATGAAGG + Intergenic
996608854 5:125356039-125356061 AAATTACACTTCACAAATGAAGG - Intergenic
997576583 5:134982598-134982620 AAATTATCCTTCAAAAATGAAGG + Intronic
997664487 5:135618735-135618757 AAATTTTCCTTCATAAATGAAGG - Intergenic
998580108 5:143364298-143364320 AATTTATCCTTCATTTTTGAAGG - Intronic
1000545233 5:162592007-162592029 AAAGTATCCTTCATAAATGATGG + Intergenic
1001726114 5:173902127-173902149 TAGTTACCTTTGATTAATTATGG + Intronic
1002084596 5:176765344-176765366 AAGTTATCCTTCAGAAGTGAAGG - Intergenic
1002731480 5:181336531-181336553 AACTTATCCTTCAAAAATGAAGG - Intergenic
1002753060 6:137558-137580 AACTTATCCTTCAAAAATGAGGG + Intergenic
1003156536 6:3601696-3601718 AAGTTATCCTTCATAAATGAAGG - Intergenic
1003622837 6:7717048-7717070 AAGCTATCCTTCAAGAATGAAGG + Intergenic
1004860316 6:19797373-19797395 AAAATATCCTTCAATAATGAAGG + Intergenic
1005985469 6:30871291-30871313 GATTTCCCCTTCATTCATGAAGG + Intergenic
1005985473 6:30871298-30871320 AAAATACCCTTCATGAATGAAGG - Intergenic
1006040142 6:31245582-31245604 TAGTTCCCTTTTATTAATGATGG - Intergenic
1006249913 6:32774345-32774367 AAGTTATCCTGCATTTATGTTGG + Intergenic
1007815387 6:44520977-44520999 AAATTATCCTTCATAAATGAAGG - Intergenic
1007871847 6:45049296-45049318 AAGATAACCTTCATTATTCAGGG + Intronic
1008671738 6:53775909-53775931 AAGCTAAGCTTCATAAATGAAGG + Intergenic
1008904834 6:56665266-56665288 TATTTAACCTTAATTAATGAGGG - Intronic
1008997631 6:57677061-57677083 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1009043024 6:58204213-58204235 AAATTATCCTTCATAAGTGAAGG - Intergenic
1009218859 6:60958465-60958487 AAATTATCCTTCATAAGTGAAGG - Intergenic
1009354597 6:62727031-62727053 AAGTTATTCTTCATAAATGAAGG - Intergenic
1009616012 6:66008493-66008515 AAATTATCCTTCATAAAGGAGGG - Intergenic
1009800088 6:68526378-68526400 AAGCTAAGCTTCATAAATGAAGG - Intergenic
1010273855 6:73946892-73946914 AAATTACCCTTCCTGAATGTAGG - Intergenic
1010306802 6:74333677-74333699 AAATTATCCTTCACAAATGAAGG - Intergenic
1010336251 6:74686653-74686675 GATTTCCTCTTCATTAATGAAGG - Intergenic
1010433603 6:75806054-75806076 AAATCAGACTTCATTAATGAAGG + Intronic
1010551846 6:77232913-77232935 AAGCTATACTTCATTACTGAAGG + Intergenic
1010674719 6:78728849-78728871 AAGGTAACCTAAATTAATGAAGG - Intergenic
1011296240 6:85829269-85829291 CAGTTATCCTTCATAAAAGAAGG + Intergenic
1011369817 6:86623990-86624012 AAATTACCATTCAATAATGAGGG - Intergenic
1011372699 6:86655053-86655075 AAAATACCCTTCAGGAATGAAGG + Intergenic
1011403807 6:86994529-86994551 AAAATATCCTTCACTAATGAAGG + Intronic
1011500518 6:87983343-87983365 AAGCTATCCTTCAGAAATGATGG + Intergenic
1011564478 6:88660048-88660070 AAATTAAGCTTCATAAATGAAGG + Intronic
1011696209 6:89915854-89915876 AAGATATTCTTCATAAATGAAGG - Intergenic
1012843368 6:104358584-104358606 AAGTTTGTCTTCTTTAATGAGGG - Intergenic
1013340672 6:109212377-109212399 AAGTTAACCTTCAGAAATGAAGG - Intergenic
1013705673 6:112831097-112831119 AAGTTACCCTTATTTAATAATGG - Intergenic
1013873047 6:114791320-114791342 AACTTAACCTGAATTAATGAAGG - Intergenic
1014060098 6:117062032-117062054 AAATTATCCTTCATAAATGAAGG - Intergenic
1014122551 6:117741709-117741731 AAGCTATTCTTCATAAATGAAGG + Intergenic
1016138806 6:140582608-140582630 AGGGTATCCTTCATAAATGAAGG + Intergenic
1016188471 6:141229028-141229050 AAATTATCCTTCAGGAATGAAGG - Intergenic
1016531491 6:145062798-145062820 AAGCTACCCTTCAGAAAGGAAGG + Intergenic
1016574334 6:145550982-145551004 CAGTTGACCTTCATTAATGTGGG - Intronic
1017974189 6:159340214-159340236 AAATTATCCTTCACAAATGAAGG + Intergenic
1018228350 6:161652409-161652431 AAATTATCATTCATAAATGAAGG + Intronic
1019141290 6:169945603-169945625 AAATTATCCTTCAAAAATGAAGG + Intergenic
1019865043 7:3700109-3700131 AATTTCCCCTTCATTCCTGAAGG - Intronic
1020052973 7:5094928-5094950 AAATTATCCTTCAAAAATGAAGG + Intergenic
1020761859 7:12277744-12277766 AAGTTATCCTTCCTAAATGAAGG - Intergenic
1020928359 7:14360589-14360611 AAGTTGCCCATCATTCAGGATGG - Intronic
1021870373 7:25000493-25000515 AAACTAACCTTCATAAATGAAGG - Intergenic
1022432734 7:30342474-30342496 AAGCTACGCTTCACAAATGAAGG - Intronic
1022610714 7:31868941-31868963 AAGGTATGCTTCATTAATGAAGG + Intronic
1022617369 7:31945464-31945486 AAATTATCCTTCATAAATGAAGG - Intronic
1022661080 7:32367082-32367104 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1022870199 7:34470178-34470200 AAGTTATCTTTCATAAATGAAGG - Intergenic
1022985872 7:35652772-35652794 AAGTTATCCTTCATAAATGAAGG + Intronic
1023208762 7:37780637-37780659 AAAATACCCTACATAAATGAAGG - Intronic
1023232353 7:38048480-38048502 AAGTTATCCTTCACAAATGAAGG - Intergenic
1023887491 7:44369980-44370002 AAGCTACCCTTTAGAAATGAGGG + Intergenic
1024015400 7:45309814-45309836 GAGTTATCTTTCATAAATGAAGG - Intergenic
1024076625 7:45823716-45823738 AACTTATCCTTCAAAAATGAGGG - Intergenic
1025127794 7:56357709-56357731 AACTTATCCTTCAAAAATGAGGG + Intergenic
1025613371 7:63097261-63097283 AAGCTTCCCTTAATCAATGATGG + Intergenic
1026885487 7:73940514-73940536 AAATTATCCTTCAGAAATGAAGG - Intergenic
1027350650 7:77307736-77307758 AAGCTATCCTTCAGAAATGAAGG - Intronic
1027781456 7:82525646-82525668 AAGTGAGCCATCATTAATGATGG + Intergenic
1028061506 7:86323545-86323567 AAGTTATCCCTCAATAATGGTGG - Intergenic
1028165297 7:87531750-87531772 AAGAAAACCTTCATTAATCACGG + Intronic
1028197966 7:87928649-87928671 AAGTAAGGCTTCATAAATGAAGG + Intergenic
1028519108 7:91709332-91709354 AAGTAATCCTTCATAAGTGAAGG + Intronic
1028626444 7:92882430-92882452 AAGCTATCCTTCATAAATGAAGG + Intergenic
1029171539 7:98632912-98632934 AAGCTATCCTTCAAAAATGAAGG + Intergenic
1031101827 7:117490548-117490570 AAGTTCACCTTTATTAGTGAGGG + Intronic
1031325365 7:120390033-120390055 AAGTTTACATTAATTAATGAGGG + Intronic
1031568804 7:123332125-123332147 AATTCACCCTTCATAAATGAAGG + Intergenic
1031683748 7:124707510-124707532 AAATTATCCTTCATACATGAAGG - Intergenic
1033623061 7:143079474-143079496 AAACTAAGCTTCATTAATGAAGG + Intergenic
1033638452 7:143236478-143236500 AAGCTATCCTTCACTAATGAAGG - Intergenic
1033677242 7:143555028-143555050 AAATTATCCTTCATAAATGAAGG - Intergenic
1033694593 7:143774407-143774429 AAATTATCCTTCATAAATGAAGG + Intergenic
1034026093 7:147706369-147706391 AAGTTGTCATTCATAAATGAAGG - Intronic
1034381562 7:150699617-150699639 AAATTACCTTTCAAAAATGAAGG + Intergenic
1035347715 7:158215781-158215803 AAGTTATCCTTCAGGAATCAGGG + Intronic
1035512033 8:197746-197768 AACTTATCCTTCAAAAATGAAGG + Intronic
1036252546 8:7175219-7175241 AAGCTATCCTTCACAAATGAAGG + Intergenic
1036364952 8:8112243-8112265 AAGCTATCCTTCACAAATGAAGG - Intergenic
1036885984 8:12553851-12553873 AAGCTATCCTTCACAAATGAAGG + Intergenic
1038221564 8:25613597-25613619 AAATTAACCTTCATAAGTGAAGG - Intergenic
1038225406 8:25652550-25652572 AAGTTATGCTTCATAAATGATGG - Intergenic
1039402435 8:37281129-37281151 AAGCTAACCTTCATAAGTGAAGG + Intergenic
1040362575 8:46681652-46681674 AAATTAAGCTTCATAAATGAAGG - Intergenic
1040645722 8:49393973-49393995 AAGTTAACCTTAATGAATGGTGG - Intergenic
1040809918 8:51440590-51440612 ATGTTACCCTTACTTACTGATGG + Intronic
1040989390 8:53333676-53333698 AAACTAAGCTTCATTAATGAAGG - Intergenic
1041176425 8:55202024-55202046 CAGTTACTCTTCTTTAATGCGGG - Intronic
1041410471 8:57548304-57548326 AAGTTATCCTTCATAAAAGTGGG + Intergenic
1041782972 8:61597782-61597804 AAGCTATCCTTCAAAAATGAAGG + Intronic
1041951521 8:63508991-63509013 AAATTAAGCTTCATAAATGAAGG - Intergenic
1041994416 8:64036335-64036357 AAGTTGTCCTTCAGCAATGAAGG + Intergenic
1042129841 8:65577450-65577472 AAATTATCCTTTATAAATGAAGG - Intergenic
1042233341 8:66581848-66581870 AAGCTATCCTTCAGAAATGAGGG + Intronic
1042633479 8:70846202-70846224 AAGTTATCCTTCATAAATGAAGG + Intergenic
1042897008 8:73681361-73681383 AAACTAAGCTTCATTAATGACGG + Intronic
1043412803 8:80016453-80016475 AAGTTATCCTTCAAAAATGAAGG + Intronic
1043551988 8:81384974-81384996 AAATTATCCTTCTTAAATGAAGG - Intergenic
1043569117 8:81581724-81581746 AAGTTATTTTTCATAAATGAAGG + Intergenic
1043841055 8:85105164-85105186 AAGTTATCCTTCATAAACCAAGG - Intergenic
1043876203 8:85489778-85489800 AAACTAATCTTCATTAATGAAGG - Intergenic
1044072569 8:87780158-87780180 AAGTTATCCTTCATAAATTAAGG + Intergenic
1044123791 8:88432519-88432541 AAGCTACTCTTCAAAAATGAAGG + Intergenic
1044451551 8:92341377-92341399 AAATTGTCCTTCAGTAATGAGGG - Intergenic
1045120042 8:99027590-99027612 AAACTACCCTTCAGAAATGAAGG - Intronic
1045634681 8:104170898-104170920 AAACTAAGCTTCATTAATGAAGG - Intronic
1045945525 8:107790727-107790749 AAATTATCCTTCATAAATGAAGG + Intergenic
1046150181 8:110213187-110213209 AAAATACCCTTCAAGAATGAAGG + Intergenic
1048432295 8:134381700-134381722 AGGTTGGCCTTCATTTATGAGGG + Intergenic
1048644260 8:136400599-136400621 AAGCTATCCTTCGTAAATGAAGG + Intergenic
1049965813 9:778286-778308 AAGCTATCCTTCAGAAATGAAGG + Intergenic
1050109877 9:2203566-2203588 AAGTTATCCTTCCAAAATGAAGG + Intergenic
1050960001 9:11717979-11718001 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1051007853 9:12369715-12369737 TAGTTAGCCTTCATTCTTGAAGG - Intergenic
1051012506 9:12435359-12435381 AAATTAACCTTAATAAATGAAGG - Intergenic
1051201951 9:14635582-14635604 AAATTATCCTTCATAAATAAAGG + Intronic
1051751002 9:20340898-20340920 TGGTTACCCTTCTTTAATTAAGG + Intergenic
1051751006 9:20340905-20340927 AATTTCCCCTTAATTAAAGAAGG - Intergenic
1051814206 9:21086768-21086790 AAGTTGACCTTCAGAAATGAGGG + Intergenic
1052072717 9:24102307-24102329 AAGTTATCCTTCAGAAATGTGGG + Intergenic
1052087470 9:24285598-24285620 AAAATATCCTTCATAAATGATGG - Intergenic
1052103111 9:24475533-24475555 AAGTTACCCTTCTTACATTATGG - Intergenic
1052649146 9:31277399-31277421 AAGTTATTCTTCATAAACGAAGG + Intergenic
1052695050 9:31867706-31867728 AAGCTATCCTTCATAAATGAAGG - Intergenic
1052899571 9:33780308-33780330 AAATTAAACTTCATAAATGAAGG + Intronic
1053181455 9:35974906-35974928 AAGCTATCCTTCAGAAATGAAGG - Intergenic
1053460382 9:38264672-38264694 AAGTTATTCTTCAAAAATGAAGG + Intergenic
1055684034 9:78751456-78751478 AAGCTATCCTTCAGAAATGAGGG - Intergenic
1056026845 9:82506509-82506531 AAATTAAGCTTCATAAATGAAGG + Intergenic
1056038903 9:82639303-82639325 AACTTACCCTTTGTAAATGAAGG + Intergenic
1056127243 9:83546409-83546431 AAATTAAGCTTCATAAATGAAGG + Intergenic
1056556347 9:87692790-87692812 AAGTTATGCTTCATAAGTGAAGG - Intronic
1056688948 9:88789470-88789492 AAGTTACTTCTCATTAATGTAGG - Intergenic
1056742699 9:89273565-89273587 AAGTTGTCTTTCATAAATGAAGG - Intergenic
1056942280 9:90965736-90965758 AAGTTGACCTTCCCTAATGAGGG - Intergenic
1057932739 9:99210228-99210250 AAGCTGTCCTTCATAAATGAAGG - Intergenic
1058204708 9:102089244-102089266 AAATTACCCTTCAAAAATGAAGG + Intergenic
1058251523 9:102703125-102703147 AAGTTATCCTTGCATAATGATGG + Intergenic
1058429429 9:104904974-104904996 CAGTTACCCTTATTTAATGCTGG + Intronic
1058491009 9:105499502-105499524 AAATTATCCTTCAGTAGTGAAGG - Intronic
1058500269 9:105607786-105607808 AAGTTAAGATTTATTAATGAGGG - Intronic
1058756948 9:108091483-108091505 AAGTTAACCTCAATCAATGAGGG + Intergenic
1058789717 9:108430859-108430881 AAACTACCCTTCAAAAATGATGG + Intergenic
1059944352 9:119393667-119393689 AATTTACCCTTGTTTAATGTGGG - Intergenic
1061830991 9:133294595-133294617 AAGCTAGCCTTCATAAATGAAGG + Intergenic
1061830992 9:133294602-133294624 AATTTATCCTTCATTTATGAAGG - Intergenic
1062692904 9:137853780-137853802 AAGTTATCCTTCAGAAATGAAGG - Intronic
1062719680 9:138032616-138032638 AAAATACCCTTCAGGAATGAAGG - Intronic
1062727740 9:138085797-138085819 AAGCTATCCTTCAGAAATGAGGG + Intronic
1062755885 9:138289041-138289063 AACTTATCCTTCAAAAATGAAGG - Intergenic
1186736726 X:12473208-12473230 AAGCTAACCTTCATAAGTGAAGG + Intronic
1187310726 X:18138815-18138837 AAATTATCCTTCACTAATGAAGG + Intergenic
1188066437 X:25666467-25666489 AAAATACCCTTCAGAAATGAAGG - Intergenic
1188663735 X:32792137-32792159 AAGGTAGCCTTCATAAATCAAGG + Intronic
1188729947 X:33633675-33633697 AAGTTATCCTTCATAAATGAAGG + Intergenic
1189303024 X:39966594-39966616 AAGGTAGCGTTCATTAATCAAGG - Intergenic
1189564445 X:42226746-42226768 AAATGATCCTTCATAAATGAAGG - Intergenic
1189661085 X:43300428-43300450 AAATTACCTTTCATAAATGAAGG - Intergenic
1190100869 X:47522155-47522177 AAGCTATCCTTCAAAAATGAAGG + Intergenic
1190156146 X:47994306-47994328 AAGTTATCCTTCAGGAATGAAGG + Intronic
1190156149 X:47994313-47994335 AATTTCCCCTTCATTCCTGAAGG - Intronic
1190721734 X:53154367-53154389 AACTTACCCTTCATTTTAGAGGG + Intergenic
1190806151 X:53839082-53839104 AAGCTATCCTTCATAAATGAAGG - Intergenic
1190925166 X:54896692-54896714 AAGTTATTTTTCATAAATGAAGG + Intergenic
1191591164 X:62887040-62887062 AAGCTAACCTTCAGAAATGAAGG - Intergenic
1192383187 X:70638388-70638410 AAGCTATCCTTCAGAAATGAAGG + Intronic
1193071559 X:77311235-77311257 ATGTTACCCTTCAATAATGTAGG + Intergenic
1193208561 X:78778384-78778406 AAACTAACCTTCATAAATGAAGG - Intergenic
1193211594 X:78812218-78812240 AAACTACCCTTCAAAAATGAAGG + Intergenic
1193267562 X:79490195-79490217 AAGTTATCCTTCAAATATGAAGG + Intergenic
1193277287 X:79604379-79604401 AAGCTAAGCTTCATAAATGAAGG + Intergenic
1193317509 X:80080611-80080633 AAATTGTCCTTCAATAATGAAGG - Intergenic
1193457766 X:81752403-81752425 AAATTAAGCTTCATAAATGAAGG - Intergenic
1193953812 X:87833976-87833998 AAATTATCCTTCATAAATGAAGG - Intergenic
1194807058 X:98343083-98343105 AAGTTAGCCTTCTTAAATAAAGG - Intergenic
1194872432 X:99148711-99148733 AAATTATCTTTCATAAATGAAGG + Intergenic
1195147060 X:102028632-102028654 AAGTTACCCTTCAAAAATAAAGG + Intergenic
1195417809 X:104639749-104639771 AAAGTATCCTTCATAAATGAAGG - Intronic
1196289914 X:113928189-113928211 AAATTACCCTTCACAAATGAAGG - Intergenic
1196699445 X:118651813-118651835 AATGTACCCTTCATACATGAGGG - Intronic
1196864997 X:120063049-120063071 AAGCTACCTTTCAGAAATGAAGG + Intergenic
1196878104 X:120173283-120173305 AAGCTACCTTTCAGAAATGAAGG - Intergenic
1197027934 X:121777950-121777972 AAACTACCCTTCATAAATGAAGG - Intergenic
1197081577 X:122424989-122425011 AAATTAAGCTTCATAAATGAAGG - Intergenic
1197105159 X:122704854-122704876 AAATTACCCTTCAAACATGAAGG + Intergenic
1197167107 X:123390360-123390382 AAGTTGCCTTTCATAAATGAAGG - Intronic
1197643335 X:128991175-128991197 AAGTTATCCTTTATAAATGAAGG - Intergenic
1198581486 X:138069905-138069927 AATTTATCCTTCATTTTTGAAGG + Intergenic
1198616619 X:138464749-138464771 AAACTACGCTTCATAAATGAAGG + Intergenic
1198712641 X:139522448-139522470 AAACTAAGCTTCATTAATGAAGG + Intergenic
1199182434 X:144874272-144874294 AAATTACTCTTCAAAAATGAAGG - Intergenic
1199282996 X:146023712-146023734 AAATTAAGCTTCATAAATGAAGG + Intergenic
1199332087 X:146574403-146574425 AAATTATCCTTCATAAATGAAGG + Intergenic
1199332089 X:146574410-146574432 TATTTTCCCTTCATTTATGAAGG - Intergenic
1199332103 X:146574538-146574560 AAATTATCCTTCATATATGAAGG - Intergenic
1199702266 X:150390897-150390919 TATTTCCCCTTCATTATTGAAGG + Intronic
1199702269 X:150390904-150390926 AAAATATCCTTCAATAATGAAGG - Intronic
1199914434 X:152323525-152323547 TTGTTACCCTTCATGAATGCTGG - Intronic
1200175596 X:154113719-154113741 AAGTTATCCTTCAAGAGTGATGG - Intergenic
1201053560 Y:9965852-9965874 AAATTAACCTTCATAAGTGAAGG - Intergenic
1201358984 Y:13126150-13126172 AAGGTATCCTTCATAAATGAAGG - Intergenic
1202276047 Y:23120451-23120473 AAGCAATCCTTCATAAATGAGGG + Intergenic
1202289981 Y:23300240-23300262 AAGCAATCCTTCATAAATGAGGG - Intergenic
1202382394 Y:24285860-24285882 AACTTATCCTTCAAAAATGAAGG - Intergenic
1202429040 Y:24754171-24754193 AAGCAATCCTTCATAAATGAGGG + Intergenic
1202441751 Y:24915918-24915940 AAGCAATCCTTCATAAATGAGGG - Intergenic
1202488390 Y:25384265-25384287 AACTTATCCTTCAAAAATGAAGG + Intergenic